G104255


Basic Information

Item Value
gene id G104255
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000018
NCBI id null
chromosome length 7078422
location 3688000 ~ 3688300 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU118570
CAAAAGTATCGACTTCGATACCAAGTCGATACTGAAATTTTAAAAATGTTAAACATTTTAAAACACCTCTGATTGACCATTGTGTTCACGTGCTCAACATTTATGTCCGTGATTGGCTACAATGATCAAAGCTTCAAAAACATGTTGTAAATAGACATCAATGACGCTCTTCACCGAGCACTTACACAGATACACACGGGAGCATTTAAAAGCAGGCATCTATCAGCGGACCGGTTTGCTGATAAGACGCCTGCTTTCAAACGCTCCCGCTTTCAAAACATTTCAAACACTTCCGTGTGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU118570 True 301 lncRNA 0.40 1 3688000 3688300

Neighbor

gene id symbol gene type direction distance location
CI01000018_03630815_03635622 NA coding upstream 52213 3630777 ~ 3635787 (+)
CI01000018_03513125_03558562 SLCO5A1 coding upstream 129280 3511362 ~ 3558720 (+)
CI01000018_03482157_03507502 SULF1 coding upstream 179534 3481433 ~ 3508466 (+)
CI01000018_03468481_03471726 NA coding upstream 216120 3468273 ~ 3471880 (+)
CI01000018_03315696_03388918 NA coding upstream 299082 3315696 ~ 3388918 (+)
CI01000018_03714508_03725674 NA coding downstream 26208 3714508 ~ 3725930 (+)
CI01000018_03727066_03727226 NA coding downstream 38766 3727066 ~ 3727308 (+)
CI01000018_03865690_03869961 NA coding downstream 177011 3865311 ~ 3870063 (+)
CI01000018_03883336_03887135 ACAA1 coding downstream 194462 3882762 ~ 3887214 (+)
CI01000018_03923541_03939515 NA coding downstream 235241 3923541 ~ 3939670 (+)
G104249 NA non-coding upstream 14938 3672861 ~ 3673062 (+)
G104229 NA non-coding upstream 72406 3615304 ~ 3615594 (+)
G104221 NA non-coding upstream 103427 3584344 ~ 3584573 (+)
G104219 NA non-coding upstream 120118 3567610 ~ 3567882 (+)
G104206 NA non-coding upstream 240928 3446845 ~ 3447072 (+)
G104257 NA non-coding downstream 1863 3690163 ~ 3690446 (+)
G104336 NA non-coding downstream 123538 3811838 ~ 3812537 (+)
G104337 NA non-coding downstream 127212 3815512 ~ 3817032 (+)
G104338 NA non-coding downstream 130088 3818388 ~ 3818677 (+)
G104339 NA non-coding downstream 132771 3821071 ~ 3821459 (+)
CI01000018_01924489_01985310 SEMA5A other upstream 1702689 1924489 ~ 1985311 (+)
G102895 NA other upstream 2102338 1582913 ~ 1585662 (+)
G104258 NA other downstream 2789 3691089 ~ 3691519 (+)
CI01000018_04368179_04375192 NA other downstream 681886 4368179 ~ 4375866 (+)
G104670 NA other downstream 1067501 4755801 ~ 4759768 (+)
CI01000018_05217404_05218896 NA other downstream 1528380 5216452 ~ 5222616 (+)
G106429 NA other downstream 3193311 6881611 ~ 6886325 (+)

Expression


Co-expression Network