G161394


Basic Information

Item Value
gene id G161394
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000030
NCBI id null
chromosome length 11638347
location 6244454 ~ 6244700 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU183266
CATTAATGAAAGTCAGTTGTAGTTCTTGTGTTTCTGCTCGTTTTTTTCCGTTCTTGTTCCTCTTTTCAGTGATTCTGCTTGTTAACAGCAGGTGTTCATCATTAATGCTCAATCATCACTTACATAATAACTTAATTATCTCACTGCAACACAGCGTCAATATTACTTTTACTCTGTAGTGAGGACACTAGAGGATGTTCCTGTGGGGTTGAAAAGGTTAAAGTTGTAAGATAAAAAGACACACCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU183266 True 247 lncRNA 0.36 1 6244454 6244700

Neighbor

gene id symbol gene type direction distance location
CI01000030_06184908_06193012 KAT14, CSRP2BP coding downstream 51442 6184613 ~ 6193012 (-)
CI01000030_06168725_06172057 POLR3F coding downstream 72397 6168454 ~ 6172057 (-)
CI01000030_06162749_06165879 NPTXRB coding downstream 77939 6161812 ~ 6166515 (-)
CI01000030_06143122_06149273 FAM20CL coding downstream 93202 6142954 ~ 6151252 (-)
CI01000030_06131710_06138371 NA coding downstream 106083 6131090 ~ 6138406 (-)
CI01000030_06383887_06390119 PDGFA, PDGFAA coding upstream 138878 6383578 ~ 6390119 (-)
CI01000030_06405632_06428709 NA coding upstream 160868 6405568 ~ 6428709 (-)
CI01000030_06430857_06435176 CCDC130 coding upstream 186062 6430762 ~ 6435176 (-)
CI01000030_06442356_06446395 MORG1, WDR83 coding upstream 197656 6442356 ~ 6446395 (-)
CI01000030_06447375_06451108 SDE2 coding upstream 202354 6447054 ~ 6451207 (-)
G161393 NA non-coding downstream 5849 6238317 ~ 6238605 (-)
G161385 NA non-coding downstream 23518 6219908 ~ 6220936 (-)
G161380 NA non-coding downstream 30880 6213231 ~ 6213574 (-)
G161377 NA non-coding downstream 50737 6193441 ~ 6193717 (-)
G161376 NA non-coding downstream 61958 6182267 ~ 6182496 (-)
G161395 NA non-coding upstream 1101 6245801 ~ 6246018 (-)
G161399 NA non-coding upstream 4134 6248834 ~ 6254739 (-)
G161522 NA non-coding upstream 307071 6551771 ~ 6554499 (-)
G161519 NA non-coding upstream 349669 6594369 ~ 6599857 (-)
CI01000030_06841490_06848643 NA non-coding upstream 596725 6841072 ~ 6848659 (-)
G160949 NA other downstream 444028 5797297 ~ 5800426 (-)
G160712 NA other downstream 732380 5456960 ~ 5512074 (-)
G160713 NA other downstream 820941 5419119 ~ 5423513 (-)
G160213 NA other downstream 2775292 3466353 ~ 3469162 (-)
CI01000030_06701334_06704398 MGC53794, FAM195A, FAM195A.S, MCRIP2 other upstream 456355 6701055 ~ 6704745 (-)
CI01000030_06747047_06752255 NA other upstream 498558 6746960 ~ 6752411 (-)
G163065 NA other upstream 679783 6924483 ~ 6925657 (-)
G163139 NA other upstream 904774 7149474 ~ 7150144 (-)
CI01000030_07736031_07737720 LSM7.L, GM13182, LSM7 other upstream 1490736 7735436 ~ 7737720 (-)

Expression


Co-expression Network