RNA id: TCONS_00016915


Basic Information

Item Value
RNA id TCONS_00016915
length 358
RNA type mRNA
GC content 0.44
exon number 4
gene id XLOC_008448
representative False

Chromosome Information

Item Value
chromosome id NC_007126.7
NCBI id CM002899.2
chromosome length 48040578
location 20403084 ~ 20405796 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GACTAGACGCGAATCAACAAGCATAACAGAGAGCAGCATCGGACATGAGGCATTTACTGCTGGCTTCACGAGCCTTCAGCACAACAGTCCGACAAATGAAGAACAGGGTGCCGGAGAAACAGAAAATTTTCCTGGAGGATAATGGTCTGCCTGTCCACATTAAAGGAGGCACAACAGATGCAATTCTGTACCGTCTGACCATGACCCTCACAGTAGTAGGCACTGGCTACTCCCTTTACTGGTTGCTGATCGCTGCTATGCCCAAACGTAAAGCATAATTCCTCTCATGCTCCATGATTCTGTATAAATCCATTTTATTTCAAAAACCTTTAACAATAAAACATGTGTAATTAAGTTC

Function

GO:

id name namespace
GO:0002082 regulation of oxidative phosphorylation biological_process
GO:0097250 mitochondrial respirasome assembly biological_process
GO:0005746 mitochondrial respirasome cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0009055 electron transfer activity molecular_function
GO:0004129 cytochrome-c oxidase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-060929-340 Predicted to enable cytochrome-c oxidase activity. Predicted to be involved in mitochondrial respirasome assembly and regulation of oxidative phosphorylation. Predicted to be located in mitochondrial inner membrane. Predicted to be integral component of membrane. Predicted to be active in mitochondrial respirasome. Orthologous to human COX7A2 (cytochrome c oxidase subunit 7A2).

Ensembl:

ensembl_id ENSDART00000152734

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00016885 lncRNA upstream 647312 19752881 ~ 19755818 (+) False XLOC_008436
TCONS_00016886 lncRNA upstream 648327 19752919 ~ 19754803 (+) True XLOC_008436
TCONS_00018924 lncRNA upstream 681376 19688987 ~ 19721754 (+) False XLOC_008435
TCONS_00018923 lncRNA upstream 694280 19688875 ~ 19708850 (+) False XLOC_008435
TCONS_00016884 lncRNA upstream 694634 19688875 ~ 19708496 (+) False XLOC_008435
TCONS_00016917 lncRNA downstream 5772 20411292 ~ 20458876 (+) False XLOC_008449
TCONS_00018925 lncRNA downstream 19114 20424634 ~ 20458876 (+) True XLOC_008449
TCONS_00016931 lncRNA downstream 477440 20882960 ~ 20885734 (+) False XLOC_008453
TCONS_00016932 lncRNA downstream 485799 20891319 ~ 20892743 (+) True XLOC_008453
TCONS_00016933 lncRNA downstream 491583 20897103 ~ 20901355 (+) True XLOC_008454
TCONS_00016913 mRNA upstream 7881 20364595 ~ 20395249 (+) True XLOC_008447
TCONS_00016912 mRNA upstream 8365 20363859 ~ 20394765 (+) False XLOC_008447
TCONS_00016908 mRNA upstream 39344 20352134 ~ 20363786 (+) False XLOC_008446
TCONS_00016918 mRNA downstream 123677 20529197 ~ 20541185 (+) False XLOC_008450
TCONS_00016919 mRNA downstream 123737 20529257 ~ 20535245 (+) False XLOC_008450
TCONS_00016920 mRNA downstream 123748 20529268 ~ 20535518 (+) False XLOC_008450
TCONS_00016922 mRNA downstream 125129 20530649 ~ 20540616 (+) True XLOC_008450
TCONS_00016923 mRNA downstream 138250 20543770 ~ 20643827 (+) False XLOC_008451
TCONS_00016911 other upstream 41158 20355795 ~ 20361972 (+) True XLOC_008446
TCONS_00016899 other upstream 404355 19990123 ~ 19998775 (+) False XLOC_008443
TCONS_00016873 other upstream 1063126 19335667 ~ 19340004 (+) True XLOC_008431
TCONS_00016870 other upstream 1073187 19324727 ~ 19329943 (+) False XLOC_008430
TCONS_00016857 other upstream 2316314 18086702 ~ 18086816 (+) True XLOC_008420
TCONS_00016921 other downstream 123760 20529280 ~ 20535484 (+) False XLOC_008450
TCONS_00016934 other downstream 761622 21167142 ~ 21177049 (+) True XLOC_008458
TCONS_00016935 other downstream 774574 21180094 ~ 21198286 (+) True XLOC_008459
TCONS_00016937 other downstream 846671 21252191 ~ 21252282 (+) True XLOC_008463
TCONS_00016942 other downstream 847059 21252579 ~ 21261192 (+) False XLOC_008464

Expression Profile

//