RNA id: TCONS_00020674


Basic Information

Item Value
RNA id TCONS_00020674
length 430
RNA type nonsense_mediated_decay
GC content 0.50
exon number 4
gene id XLOC_010543
representative True

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 14383479 ~ 14397003 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCTGGTACCTGGAAAATGAAGAGCTCTGAGAACTTCGAAGAGCTTCTTAAAGCACTAGGTGTGAACGTGATGCTCCGTAAGATTGCGGTTGCAGCTGCATCAAAACCATCCGTGGAGATTACACAGGAGGGAGAGACACTGACAATCAAGACGTCCACCTCAGTGAGGACCACCAACGTCACCTTCACAGTTGGACAGGAGTTTAATGAGGCCACTGTGGATGGACGTCCCTGCACGTCACAGACCAAGACCTACTCATATTTGTCTGTCTCTGCTTCTCTCAGAGCTTTCCTCGCTGGGTAACAGACAGCAAGATTAGCTGCGAACAGACTTTGCAGAAGGGCGAGGGTCCAAAAACCTCATGGACCAGGGAAATAACCAATGATGCTGAATTGATTCTGACCATGACTGCTGACGATGTGGTGTGTAC

Function

GO:

id name namespace
GO:0021575 hindbrain morphogenesis biological_process
GO:0048385 regulation of retinoic acid receptor signaling pathway biological_process
GO:0005634 nucleus cellular_component
GO:0005737 cytoplasm cellular_component
GO:0001972 retinoic acid binding molecular_function
GO:0008289 lipid binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-020320-4 Predicted to enable retinoic acid binding activity. Acts upstream of or within hindbrain morphogenesis and regulation of retinoic acid receptor signaling pathway. Predicted to be located in cytoplasm and nucleus. Is expressed in several structures, including central nervous system; immature eye; neural keel; neural rod; and pleuroperitoneal region. Orthologous to human CRABP2 (cellular retinoic acid binding protein 2).

Ensembl:

ensembl_id ENSDART00000113913

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00020668 lncRNA downstream 217647 14093781 ~ 14167673 (-) True XLOC_010540
TCONS_00022133 lncRNA downstream 294618 14088331 ~ 14090702 (-) True XLOC_010539
TCONS_00022132 lncRNA downstream 379711 13976380 ~ 14005609 (-) True XLOC_010536
TCONS_00020659 lncRNA downstream 524756 13857672 ~ 13860564 (-) True XLOC_010530
TCONS_00020658 lncRNA downstream 525057 13857672 ~ 13860263 (-) False XLOC_010530
TCONS_00020675 lncRNA upstream 19647 14416346 ~ 14417407 (-) True XLOC_010544
TCONS_00020676 lncRNA upstream 25101 14421800 ~ 14428968 (-) False XLOC_010545
TCONS_00021789 lncRNA upstream 25455 14422154 ~ 14424198 (-) False XLOC_010545
TCONS_00020677 lncRNA upstream 29750 14426449 ~ 14428968 (-) False XLOC_010545
TCONS_00021790 lncRNA upstream 30161 14426860 ~ 14433656 (-) False XLOC_010545
TCONS_00020672 mRNA downstream 31753 14280496 ~ 14353567 (-) True XLOC_010542
TCONS_00020671 mRNA downstream 52759 14276364 ~ 14332561 (-) False XLOC_010542
TCONS_00020670 mRNA downstream 52759 14276364 ~ 14332561 (-) False XLOC_010542
TCONS_00020669 mRNA downstream 136428 14231406 ~ 14248892 (-) True XLOC_010541
TCONS_00020667 mRNA downstream 310726 14064397 ~ 14074594 (-) True XLOC_010538
TCONS_00020681 mRNA upstream 131675 14528374 ~ 14534724 (-) False XLOC_010546
TCONS_00020682 mRNA upstream 131857 14528556 ~ 14552199 (-) True XLOC_010546
TCONS_00020683 mRNA upstream 175309 14572008 ~ 14587332 (-) True XLOC_010547
TCONS_00020684 mRNA upstream 655814 15052513 ~ 15097513 (-) True XLOC_010548
TCONS_00020685 mRNA upstream 768284 15164983 ~ 15263099 (-) True XLOC_010549
TCONS_00020665 other downstream 426435 13957756 ~ 13958885 (-) True XLOC_010535
TCONS_00020657 other downstream 567380 13813970 ~ 13817940 (-) True XLOC_010529
TCONS_00020651 other downstream 714101 13668166 ~ 13671219 (-) True XLOC_010526
TCONS_00020641 other downstream 842860 13522299 ~ 13542460 (-) False XLOC_010519
TCONS_00020613 other downstream 1890903 12474861 ~ 12494417 (-) False XLOC_010505
TCONS_00020689 other upstream 1416807 15813506 ~ 15814501 (-) True XLOC_010554
TCONS_00020706 other upstream 2176715 16573414 ~ 16573530 (-) True XLOC_010567
TCONS_00020716 other upstream 2281009 16677708 ~ 16692267 (-) True XLOC_010571
TCONS_00020722 other upstream 2723365 17120064 ~ 17120186 (-) True XLOC_010576
TCONS_00020724 other upstream 2725299 17121998 ~ 17129466 (-) False XLOC_010577

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000016_06131958_06135495.mRNA True 1733 mRNA 0.39 4 CI01000016 6130778 ~ 6135495 (-)