RNA id: TCONS_00030937


Basic Information

Item Value
RNA id TCONS_00030937
length 458
RNA type mRNA
GC content 0.53
exon number 2
gene id XLOC_015467
representative False

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 25860344 ~ 25990784 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTGTGTAAACAGCTTTATTTGTCAGGATGTTCTGAAGAGAATGATTTCATGGGCTGAAAGTGGCTCAGACTGTATCTGATCCTCATGAACTCTGGAGCGGCTCCTGTTTGAAGAACCTCCAGGCATTTCCTGAGCAGTCATGAACTTCCCAAATGACATGATCCCTTGCTTCACCTTCACCCTCACTGGATATGTGGAAAAATCTGATAATGACGCTCCTCTAGAGGACAGTGATCTTCACAGCCGCTTTCTGTCTGAACCTTCTCCCAAAGCTTCATCAGACCCTCATCCTCCTCAGAGCCTCAGCCCCATCTCCTGAATCCCTCTGACCCACGAGCAGGCTCCAGGATGAGCGGCCTCTTCGCCAAACTGGACCCGCGCCGGGTTCAATGGGGGGCCAACTGGTTTGCCTTCCGGTCCCGCGTTCTGCGCACAAAGCCTGTGGAGTCCATGCTGGA

Function

GO:

id name namespace
GO:0055085 transmembrane transport biological_process
GO:0001654 eye development biological_process
GO:0006865 amino acid transport biological_process
GO:0005764 lysosome cellular_component
GO:0005765 lysosomal membrane cellular_component
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0015171 amino acid transmembrane transporter activity molecular_function
GO:0022857 transmembrane transporter activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-070912-112 Predicted to enable amino acid transmembrane transporter activity. Acts upstream of or within eye development. Predicted to be located in lysosomal membrane. Predicted to be integral component of membrane. Predicted to be active in plasma membrane. Human ortholog(s) of this gene implicated in retinitis pigmentosa 68. Orthologous to human SLC7A14 (solute carrier family 7 member 14).

Ensembl:

ensembl_id ENSDART00000143517

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00030930 lncRNA upstream 31572 25834095 ~ 25836832 (+) True XLOC_015465
TCONS_00030924 lncRNA upstream 486063 25315658 ~ 25382341 (+) False XLOC_015463
TCONS_00030918 lncRNA upstream 730615 25130523 ~ 25137789 (+) True XLOC_015461
TCONS_00033263 lncRNA upstream 940650 24912293 ~ 24927754 (+) True XLOC_015456
TCONS_00033543 lncRNA upstream 961789 24903666 ~ 24906615 (+) True XLOC_015455
TCONS_00033544 lncRNA downstream 218943 26166578 ~ 26167419 (+) True XLOC_015470
TCONS_00030948 lncRNA downstream 341667 26289302 ~ 26290690 (+) True XLOC_015474
TCONS_00030952 lncRNA downstream 535262 26482897 ~ 26483391 (+) False XLOC_015476
TCONS_00030953 lncRNA downstream 544124 26491759 ~ 26494145 (+) False XLOC_015476
TCONS_00030954 lncRNA downstream 546665 26494300 ~ 26495044 (+) True XLOC_015476
TCONS_00030931 mRNA upstream 23067 25839193 ~ 25845337 (+) False XLOC_015466
TCONS_00030933 mRNA upstream 24831 25839698 ~ 25843573 (+) False XLOC_015466
TCONS_00030932 mRNA upstream 24837 25839650 ~ 25843567 (+) False XLOC_015466
TCONS_00030935 mRNA upstream 25106 25840463 ~ 25843298 (+) True XLOC_015466
TCONS_00030934 mRNA upstream 27319 25839940 ~ 25841085 (+) False XLOC_015466
TCONS_00030941 mRNA downstream 112893 26060528 ~ 26156784 (+) True XLOC_015469
TCONS_00030942 mRNA downstream 231461 26179096 ~ 26209425 (+) True XLOC_015471
TCONS_00030943 mRNA downstream 289687 26237322 ~ 26284210 (+) False XLOC_015472
TCONS_00030944 mRNA downstream 292704 26240339 ~ 26282973 (+) False XLOC_015472
TCONS_00030945 mRNA downstream 292996 26240631 ~ 26284245 (+) True XLOC_015472
TCONS_00030908 other upstream 1022405 24842587 ~ 24845999 (+) True XLOC_015452
TCONS_00030897 other upstream 1327639 24540047 ~ 24540765 (+) False XLOC_015445
TCONS_00030898 other upstream 1327679 24540209 ~ 24540725 (+) True XLOC_015445
TCONS_00030891 other upstream 1370563 24484289 ~ 24497841 (+) True XLOC_015443
TCONS_00030885 other upstream 1517364 24348589 ~ 24351040 (+) True XLOC_015440
TCONS_00030940 other downstream 86540 26034175 ~ 26039606 (+) True XLOC_015468
TCONS_00030946 other downstream 338830 26286465 ~ 26287505 (+) True XLOC_015473
TCONS_00030957 other downstream 550899 26498534 ~ 26501294 (+) False XLOC_015477
TCONS_00030958 other downstream 550926 26498561 ~ 26501275 (+) False XLOC_015477
TCONS_00030959 other downstream 550927 26498562 ~ 26501305 (+) False XLOC_015477

Expression Profile

//