RNA id: TCONS_00033151


Basic Information

Item Value
RNA id TCONS_00033151
length 489
lncRNA type retained_intron
GC content 0.47
exon number 3
gene id XLOC_016980
representative True

Chromosome Information

Item Value
chromosome id NC_007113.7
NCBI id CM002886.2
chromosome length 59640629
location 57310523 ~ 57379216 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TACATTTGTAGCGCCCAAAATAATTAGAATAGAACTTTAAGCAGAGTTACATTTGAGCACTATTACATCGTAACACTTGTCGACGCGGACTGTTCGCGTCTGCCGGGAAATAGGACGCATTTTGCACCGTGATTTAGCGGGACCTGAGACACGGAGGGGGGAAATTTTGTCCCCCAACTTTTCTGTTTTTCCTCTCAGGCTGAAGCGCGTTTCTCTCCCGCTGGATGCCGCGCGCGTGACGCGAGAAACAGATCGTAAAGCTGTTTGAGCTGAAAGAAAGACGTCTATCAAGAGAAGCAGATCAGGATGGCGACGGTGGGGACCGACATGGAGCTCAATGACCTGTTGGATTTCAGTATTATGTTCCCTCATCCAATGTCAAACGGGAAAAGCAGAGGCCCCAATATACCCAGCAGTCAGTTCGGTAGGCACTTTTATATTCTCACTTCAACATGACTTGAGTAACTTTGACTCTGATTATAGAAACGA

Function

GO:

id name namespace
GO:0055002 striated muscle cell development biological_process
GO:0045666 positive regulation of neuron differentiation biological_process
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0005634 nucleus cellular_component
GO:0005667 transcription regulator complex cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0042803 protein homodimerization activity molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0043425 bHLH transcription factor binding molecular_function
GO:0046982 protein heterodimerization activity molecular_function
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-990415-51 Enables sequence-specific DNA binding activity. Acts upstream of or within striated muscle cell development. Predicted to be part of transcription regulator complex. Is expressed in heart. Human ortholog(s) of this gene implicated in agammaglobulinemia and colorectal cancer. Orthologous to human TCF3 (transcription factor 3).

Ensembl:

ensembl_id ENSDART00000150122

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00033150 lncRNA downstream 36739 57329205 ~ 57332270 (-) False XLOC_016980
TCONS_00033428 lncRNA downstream 84297 57268785 ~ 57284712 (-) True XLOC_016979
TCONS_00034001 lncRNA downstream 164563 57203011 ~ 57204446 (-) True XLOC_016976
TCONS_00034000 lncRNA downstream 307074 57053019 ~ 57061935 (-) False XLOC_016972
TCONS_00033427 lncRNA downstream 544050 56809292 ~ 56824959 (-) False XLOC_016971
TCONS_00034002 lncRNA upstream 22167 57400996 ~ 57404902 (-) False XLOC_016981
TCONS_00034003 lncRNA upstream 22167 57400996 ~ 57405728 (-) True XLOC_016981
TCONS_00033154 lncRNA upstream 38231 57417060 ~ 57420639 (-) True XLOC_016982
TCONS_00033429 lncRNA upstream 55166 57433995 ~ 57434621 (-) True XLOC_016983
TCONS_00033158 lncRNA upstream 80309 57459138 ~ 57473919 (-) True XLOC_016984
TCONS_00033148 mRNA downstream 24972 57317508 ~ 57344037 (-) False XLOC_016980
TCONS_00033144 mRNA downstream 104675 57247222 ~ 57264334 (-) True XLOC_016978
TCONS_00033142 mRNA downstream 104697 57239983 ~ 57264312 (-) False XLOC_016978
TCONS_00033141 mRNA downstream 104747 57239978 ~ 57264262 (-) False XLOC_016978
TCONS_00033143 mRNA downstream 104747 57247222 ~ 57264262 (-) False XLOC_016978
TCONS_00033152 mRNA upstream 38015 57416844 ~ 57443210 (-) False XLOC_016982
TCONS_00033153 mRNA upstream 38022 57416851 ~ 57443210 (-) False XLOC_016982
TCONS_00033155 mRNA upstream 68276 57447105 ~ 57469115 (-) False XLOC_016984
TCONS_00033156 mRNA upstream 68276 57447105 ~ 57473991 (-) False XLOC_016984
TCONS_00033157 mRNA upstream 69472 57448301 ~ 57473980 (-) False XLOC_016984
TCONS_00033146 other downstream 81751 57268782 ~ 57287258 (-) False XLOC_016979
TCONS_00033145 other downstream 99851 57268781 ~ 57269158 (-) False XLOC_016979
TCONS_00033137 other downstream 265524 57103401 ~ 57103485 (-) True XLOC_016974
TCONS_00033134 other downstream 307216 57058078 ~ 57061793 (-) True XLOC_016972
TCONS_00033120 other downstream 1326379 56042512 ~ 56042630 (-) True XLOC_016962
TCONS_00033170 other upstream 561851 57940680 ~ 57941863 (-) True XLOC_016993
TCONS_00033188 other upstream 1257847 58636676 ~ 58636792 (-) True XLOC_017010
TCONS_00033190 other upstream 1489280 58868109 ~ 58869453 (-) True XLOC_017015
TCONS_00033196 other upstream 1659366 59038195 ~ 59038312 (-) True XLOC_017019
TCONS_00033197 other upstream 1723340 59102169 ~ 59102252 (-) True XLOC_017022

Expression Profile

//