RNA id: TCONS_00039772


Basic Information

Item Value
RNA id TCONS_00039772
length 831
RNA type mRNA
GC content 0.58
exon number 3
gene id XLOC_019936
representative False

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 1170294 ~ 1182165 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GATTCAGAGAAATGCCCGTGACGTCATCGCTGTACCTGAGTTTCGGCAGAGGGTGAAACTCTCGAGCAGAGATTCAGACACACATGAAACTCAGTTTCACACACTTTCACACGGACACACGGATATTCTGCGAGTCGTATCTCTCACCTGTGACTGACATACACAGACATTAAACACGTTTATTCATAAAAACCGTTCGTTTTGGCGGCAAAGGCCTCAGGATTGTGCTCCTCCTCCTGCTCTTCCTCCTCCCCCTGCTCTTCCCCCTCCGGCCGCCACCGTTCTTCCGGCCGCCGCCGCTCCTCCTGCTAATGTTTGGCCCAAGAAGGAGCCGGAGGACGTGGAGATGCAGCCGCCCCCCATGGAGATACAGACGCCCACCGCTCTCGACAACCTGTTCATCACGCCGGAGACCTGGATCAGCTCTCTGCCCATGACGGATCTGGAGGTGCAGTTCTACTACCGCGGTAAAGAGGTGTGTCCCCCATTGACGGTCAGTAACCCGCAGGGCTGTCGTCTGTTTTACGGGGACCTGGGCCCCATAGTGAACCAAGAGGAGCTGTTCGGCCCCGTGAGCCTGGAGCAGGTGCGCTTCCCGCCCACAGAGCACATCGCTAACGATAAGCAGCGCGTGTTCACTAGCCGGCTGCTGGACGTGATGGACCGCGGGCTCATCCTGGAGGTCAGCGGGCACGACATCTACGCCGTGCGCCTCTGCCAGTGTAAGGTGTACTGGTCCGGTCCCTGCGCCCCCAACCCAAACGCTCCCAACCTGATCGAGCGCCAGCAAAAGGTCAAGCTCTTCTGCCTCGAGTCCTTTCTCAGCGGTGA

Function

GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0060429 epithelium development biological_process
GO:0002376 immune system process biological_process
GO:0048702 embryonic neurocranium morphogenesis biological_process
GO:0005634 nucleus cellular_component
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function

KEGG:

id description
ko03000 Transcription factors
ko04147 Exosome

ZFIN:

id description
ZDB-GENE-040426-1137 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in epidermis development. Acts upstream of or within embryonic neurocranium morphogenesis and epithelium development. Predicted to be active in nucleus. Is expressed in several structures, including blastoderm; digestive system; forerunner cell group; head; and sensory system. Human ortholog(s) of this gene implicated in several diseases, including Van der Woude syndrome; cleft lip; orofacial cleft 6; popliteal pterygium syndrome; and syndactyly. Orthologous to human IRF6 (interferon regulatory factor 6).

Ensembl:

ensembl_id ENSDART00000159761

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00039764 lncRNA upstream 103450 1062851 ~ 1066844 (+) True XLOC_019931
TCONS_00039763 lncRNA upstream 111741 1055718 ~ 1058553 (+) False XLOC_019931
TCONS_00042008 lncRNA upstream 231467 923511 ~ 938827 (+) True XLOC_019927
TCONS_00042007 lncRNA upstream 352667 811600 ~ 817627 (+) True XLOC_019924
TCONS_00039751 lncRNA upstream 361837 807453 ~ 808457 (+) True XLOC_019923
TCONS_00042009 lncRNA downstream 17233 1194871 ~ 1195348 (+) True XLOC_019937
TCONS_00039777 lncRNA downstream 84087 1261725 ~ 1267820 (+) True XLOC_019938
TCONS_00042010 lncRNA downstream 139114 1316752 ~ 1364861 (+) True XLOC_019944
TCONS_00042011 lncRNA downstream 139823 1317461 ~ 1329150 (+) False XLOC_019943
TCONS_00039787 lncRNA downstream 199693 1377331 ~ 1384069 (+) True XLOC_019947
TCONS_00039771 mRNA upstream 23305 1138017 ~ 1146989 (+) True XLOC_019935
TCONS_00039770 mRNA upstream 23324 1137997 ~ 1146970 (+) False XLOC_019935
TCONS_00039769 mRNA upstream 40031 1123873 ~ 1130263 (+) True XLOC_019934
TCONS_00039768 mRNA upstream 42500 1123110 ~ 1127794 (+) False XLOC_019934
TCONS_00039767 mRNA upstream 49419 1110855 ~ 1120875 (+) True XLOC_019933
TCONS_00039774 mRNA downstream 9228 1186866 ~ 1203405 (+) False XLOC_019937
TCONS_00039778 mRNA downstream 99042 1276680 ~ 1282346 (+) True XLOC_019939
TCONS_00039779 mRNA downstream 107544 1285182 ~ 1290139 (+) True XLOC_019940
TCONS_00039780 mRNA downstream 114013 1291651 ~ 1294899 (+) True XLOC_019941
TCONS_00039781 mRNA downstream 122949 1300587 ~ 1307143 (+) True XLOC_019942
TCONS_00039761 other upstream 130545 1039548 ~ 1039749 (+) True XLOC_019930
TCONS_00039759 other upstream 151142 1018601 ~ 1019152 (+) True XLOC_019929
TCONS_00039750 other upstream 362780 803504 ~ 807514 (+) False XLOC_019923
TCONS_00039775 other downstream 72150 1249788 ~ 1262272 (+) False XLOC_019938
TCONS_00039776 other downstream 72601 1250239 ~ 1251660 (+) False XLOC_019938
TCONS_00039784 other downstream 145876 1323514 ~ 1329146 (+) True XLOC_019943
TCONS_00039812 other downstream 399225 1576863 ~ 1577746 (+) True XLOC_019963
TCONS_00039818 other downstream 453048 1630686 ~ 1633449 (+) False XLOC_019968

Expression Profile

//