RNA id: TCONS_00042009


Basic Information

Item Value
RNA id TCONS_00042009
length 229
lncRNA type sense_over
GC content 0.54
exon number 2
gene id XLOC_019937
representative True

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 1186866 ~ 1203405 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGTCGCGACTCCACCCACTTCCAGAAACAACTCCACCCATACTAAAGTAGTGGCCCCACCTCCTCAAACAAAAACTCCACCTCACAAACAGACCACACCCCCTCGTACAGAAGAACCGCCCGTCAGAGAGGCCCCGCCCCCTCAGAAGCCATATACGGAGCGTGAGAGGAACGTGGATATCCTGAATCACCTTATTAACGACATCGAAGCGTTCGTTGGCAGACTGACG

Function

GO:

id name namespace
GO:0035023 regulation of Rho protein signal transduction biological_process
GO:0007266 Rho protein signal transduction biological_process
GO:1900029 positive regulation of ruffle assembly biological_process
GO:0032587 ruffle membrane cellular_component
GO:0005886 plasma membrane cellular_component
GO:0003779 actin binding molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00039764 lncRNA upstream 128027 1062851 ~ 1066844 (+) True XLOC_019931
TCONS_00039763 lncRNA upstream 136318 1055718 ~ 1058553 (+) False XLOC_019931
TCONS_00042008 lncRNA upstream 256044 923511 ~ 938827 (+) True XLOC_019927
TCONS_00042007 lncRNA upstream 377244 811600 ~ 817627 (+) True XLOC_019924
TCONS_00042006 lncRNA upstream 386414 803504 ~ 808457 (+) False XLOC_019923
TCONS_00039777 lncRNA downstream 66377 1261725 ~ 1267820 (+) True XLOC_019938
TCONS_00042010 lncRNA downstream 121404 1316752 ~ 1364861 (+) True XLOC_019944
TCONS_00042011 lncRNA downstream 122113 1317461 ~ 1329150 (+) False XLOC_019943
TCONS_00039787 lncRNA downstream 181983 1377331 ~ 1384069 (+) True XLOC_019947
TCONS_00041847 lncRNA downstream 464839 1660187 ~ 1665471 (+) False XLOC_019971
TCONS_00039773 mRNA upstream 12706 1170295 ~ 1182165 (+) True XLOC_019936
TCONS_00039772 mRNA upstream 17233 1170294 ~ 1177638 (+) False XLOC_019936
TCONS_00039771 mRNA upstream 47882 1138017 ~ 1146989 (+) True XLOC_019935
TCONS_00039770 mRNA upstream 47901 1137997 ~ 1146970 (+) False XLOC_019935
TCONS_00039769 mRNA upstream 64608 1123873 ~ 1130263 (+) True XLOC_019934
TCONS_00039778 mRNA downstream 81332 1276680 ~ 1282346 (+) True XLOC_019939
TCONS_00039779 mRNA downstream 89834 1285182 ~ 1290139 (+) True XLOC_019940
TCONS_00039780 mRNA downstream 96303 1291651 ~ 1294899 (+) True XLOC_019941
TCONS_00039781 mRNA downstream 105239 1300587 ~ 1307143 (+) True XLOC_019942
TCONS_00039782 mRNA downstream 117698 1313046 ~ 1322968 (+) False XLOC_019943
TCONS_00039761 other upstream 155122 1039548 ~ 1039749 (+) True XLOC_019930
TCONS_00039759 other upstream 175719 1018601 ~ 1019152 (+) True XLOC_019929
TCONS_00039750 other upstream 387357 803504 ~ 807514 (+) False XLOC_019923
TCONS_00039775 other downstream 54440 1249788 ~ 1262272 (+) False XLOC_019938
TCONS_00039776 other downstream 54891 1250239 ~ 1251660 (+) False XLOC_019938
TCONS_00039784 other downstream 128166 1323514 ~ 1329146 (+) True XLOC_019943
TCONS_00039812 other downstream 381515 1576863 ~ 1577746 (+) True XLOC_019963
TCONS_00039818 other downstream 435338 1630686 ~ 1633449 (+) False XLOC_019968

Expression Profile

//