RNA id: TCONS_00041489


Basic Information

Item Value
RNA id TCONS_00041489
length 1189
RNA type mRNA
GC content 0.52
exon number 1
gene id XLOC_021123
representative True

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 21475648 ~ 21476836 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AATGGATGACGAGCTTGAACCTGGAATGAATGATGTTATAGTTAGCCACTACAACCACTCAGGCAAGTGGGGAAGACCAAGAAGCACTGGTATGTGTAAGACGGCCTTCCTGATGTGCATCTGTGCTCTGATCGTGATTGAGAACATTACTGTCCTTCTGGCACTATGGCGCAACAAGCGCTTCCACAGCCGCATGTACTTTCTCATCGGCAATCTGGCACTTTCTGACTTGTTAGCTGGAGTGGCATATGTGGTCAACATCTTCACCTCCGGCCGTAATACCTTTTTCCTCAGCCCTGGCCAGTGGCTGCTGCGAGAGGGGAGTATGTTTGTGGCACTTAGCGCTTCGACTTTTAGCTTGCTCGCTATTGGGATTGAGCGCCACATGACGATGGTTCGTTTGCGGCCTTGTGAGACCGCAGGAAGGGGAAGGTTACTAGCTCTCCTGGGAGCCTGCTGGGCAGTTTCAGTTCTCTTGAGTGCCTTGCCAAGCCTCGGTTGGAACTGTTTGGACCGAGTCCACACCTGCTCCACTGTCCTACCACTGTACGACAAAAGCTACATAGCTTTCTGCATCAGTGTCTTCACAGCCCTCCTAGCAGCAATTGTAGTCCTCTATGTGCGCATCTACCAACTTGTGACATCTAGTGGGCGAAGAGTAAGTTCTCGTCCATCAGATCGGTCGCTCGCTCTTCTGCGCACAGTAGTGATAGTACTAGGGGTTTTTGTGGCATGCTGGGCTCCTCTTTTTTCACTACTGCTGCTTGATGTGGGATGCAGTCCAGAGCAGTGCCCGATTCTCTACAAGGTGGACTGGTTCATCGCTCTGGCTGTGCTCAACTCTGCTCTCAACCCACTGATCTACACGTTTTCCAGCAGAGAAATGCGAACTGCTTTCCTCCGTGTGCTGTGCTGTTGTCAAACCTCACTGGACTCTATGCCAACAGTGGCAGGGACGGCACTTCCGGGAATAGTCATACATACCGCAGAGAACAGCAAATCTAGCATGGCTGGAGCAGGTAGTGGTGCAGCCAAGTCATCATTAATGCAAAGTAAAGTTCCCACTCCGTCAAACTCCCACCATCAGGATCCTTCACAAACGGCTGTCACACACTCCTCAGGCCCAGGTAACCTGCTATCTGCGGTGCTGGTTAAAGCTGGGGCTCTTCCCGCTTTGGGGAAGTTCTGA

Function

GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0007189 adenylate cyclase-activating G protein-coupled receptor signaling pathway biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0007165 signal transduction biological_process
GO:0005886 plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0038036 sphingosine-1-phosphate receptor activity molecular_function
GO:0004930 G protein-coupled receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-050208-347 Predicted to enable G protein-coupled receptor activity. Predicted to be involved in adenylate cyclase-activating G protein-coupled receptor signaling pathway and regulation of metabolic process. Predicted to act upstream of or within G protein-coupled receptor signaling pathway. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in cytoplasm and plasma membrane. Is expressed in brain; eye; heart; pleuroperitoneal region; and solid lens vesicle. Orthologous to human S1PR3 (sphingosine-1-phosphate receptor 3).

Ensembl:

ensembl_id ENSDART00000135977

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00042396 lncRNA downstream 354552 21119896 ~ 21121096 (-) True XLOC_021118
TCONS_00041468 lncRNA downstream 759620 20715057 ~ 20716028 (-) True XLOC_021110
TCONS_00042395 lncRNA downstream 928108 20522204 ~ 20547540 (-) True XLOC_021107
TCONS_00042394 lncRNA downstream 1837619 19622740 ~ 19638029 (-) True XLOC_021094
TCONS_00042393 lncRNA downstream 1873186 19598045 ~ 19602462 (-) True XLOC_021093
TCONS_00042397 lncRNA upstream 67374 21544210 ~ 21547856 (-) False XLOC_021124
TCONS_00042398 lncRNA upstream 67374 21544210 ~ 21547893 (-) True XLOC_021124
TCONS_00041492 lncRNA upstream 199280 21676116 ~ 21677168 (-) False XLOC_021125
TCONS_00042399 lncRNA upstream 473866 21950702 ~ 21954981 (-) False XLOC_021129
TCONS_00042400 lncRNA upstream 473866 21950702 ~ 21955166 (-) True XLOC_021129
TCONS_00041487 mRNA downstream 82900 21359164 ~ 21392748 (-) False XLOC_021122
TCONS_00041488 mRNA downstream 87194 21385391 ~ 21388454 (-) True XLOC_021122
TCONS_00041486 mRNA downstream 160788 21313332 ~ 21314860 (-) True XLOC_021121
TCONS_00041485 mRNA downstream 160827 21313332 ~ 21314821 (-) False XLOC_021121
TCONS_00041484 mRNA downstream 299379 21168587 ~ 21176269 (-) True XLOC_021120
TCONS_00041490 mRNA upstream 195820 21672656 ~ 21676364 (-) False XLOC_021125
TCONS_00041491 mRNA upstream 195820 21672656 ~ 21755524 (-) False XLOC_021125
TCONS_00041493 mRNA upstream 217167 21694003 ~ 21755966 (-) True XLOC_021125
TCONS_00041494 mRNA upstream 317201 21794037 ~ 21845685 (-) True XLOC_021126
TCONS_00041495 mRNA upstream 375234 21852070 ~ 21897279 (-) False XLOC_021127
TCONS_00041483 other downstream 299504 21167096 ~ 21176144 (-) False XLOC_021120
TCONS_00041481 other downstream 356632 21118902 ~ 21119016 (-) True XLOC_021117
TCONS_00041464 other downstream 985091 20490441 ~ 20490557 (-) True XLOC_021106
TCONS_00041451 other downstream 1213749 20256767 ~ 20261899 (-) True XLOC_021099
TCONS_00041449 other downstream 1309065 20165683 ~ 20166583 (-) True XLOC_021098
TCONS_00041498 other upstream 456289 21933125 ~ 21937488 (-) True XLOC_021128
TCONS_00041511 other upstream 1056750 22533586 ~ 22534463 (-) True XLOC_021139
TCONS_00041513 other upstream 1348954 22825790 ~ 22825878 (-) False XLOC_021142
TCONS_00041514 other upstream 1467625 22944461 ~ 22944585 (-) True XLOC_021143
TCONS_00041524 other upstream 2019979 23496815 ~ 23496929 (-) True XLOC_021149

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000030_04308370_04309677.mRNA True 1465 mRNA 0.52 1 CI01000030 4308213 ~ 4309677 (-)