RNA id: TCONS_00043945


Basic Information

Item Value
RNA id TCONS_00043945
length 96
RNA type miRNA
GC content 0.48
exon number 1
gene id XLOC_022260
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 18382297 ~ 18385168 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GGGGGCTGTGGAATGAGGTAGTAGTTTGTATAGTTTGGGATCACACCAGATCTGGGAGATAACTATACAGCCTACTGTCTTTCTCACAGCTGCTCC

Function

GO:

id name namespace
GO:0070509 calcium ion import biological_process
GO:0070838 divalent metal ion transport biological_process
GO:0070588 calcium ion transmembrane transport biological_process
GO:0072511 divalent inorganic cation transport biological_process
GO:0097503 sialylation biological_process
GO:0006816 calcium ion transport biological_process
GO:0031224 intrinsic component of membrane cellular_component
GO:1990351 transporter complex cellular_component
GO:0034702 ion channel complex cellular_component
GO:0034703 cation channel complex cellular_component
GO:0034704 calcium channel complex cellular_component
GO:0044425 obsolete membrane part cellular_component
GO:0005891 voltage-gated calcium channel complex cellular_component
GO:1902495 transmembrane transporter complex cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0022803 passive transmembrane transporter activity molecular_function
GO:0022832 voltage-gated channel activity molecular_function
GO:0022836 gated channel activity molecular_function
GO:0022839 ion gated channel activity molecular_function
GO:0046873 metal ion transmembrane transporter activity molecular_function
GO:0022843 voltage-gated cation channel activity molecular_function
GO:0015267 channel activity molecular_function
GO:0005216 ion channel activity molecular_function
GO:0005244 voltage-gated ion channel activity molecular_function
GO:0005245 voltage-gated calcium channel activity molecular_function
GO:0005261 cation channel activity molecular_function
GO:0005262 calcium channel activity molecular_function
GO:0015085 calcium ion transmembrane transporter activity molecular_function
GO:0008331 high voltage-gated calcium channel activity molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

Ensembl:

ensembl_id ENSDART00000115522

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00043941 lncRNA downstream 259801 18119854 ~ 18122655 (-) True XLOC_022257
TCONS_00044726 lncRNA downstream 308037 18073715 ~ 18074419 (-) True XLOC_022256
TCONS_00043938 lncRNA downstream 324544 18038074 ~ 18057912 (-) True XLOC_022254
TCONS_00043926 lncRNA downstream 364585 18017200 ~ 18017871 (-) True XLOC_022252
TCONS_00044981 lncRNA downstream 496605 17881023 ~ 17885851 (-) True XLOC_022251
TCONS_00044984 lncRNA upstream 4236 18386787 ~ 18392290 (-) False XLOC_022261
TCONS_00043951 lncRNA upstream 189108 18571659 ~ 18572645 (-) True XLOC_022263
TCONS_00043952 lncRNA upstream 191670 18574221 ~ 18578522 (-) False XLOC_022264
TCONS_00044727 lncRNA upstream 486666 18869217 ~ 18870954 (-) False XLOC_022272
TCONS_00044985 lncRNA upstream 486865 18869416 ~ 18884382 (-) False XLOC_022272
TCONS_00043944 mRNA downstream 1095 18372048 ~ 18381361 (-) True XLOC_022259
TCONS_00043943 mRNA downstream 94838 18180899 ~ 18287618 (-) True XLOC_022258
TCONS_00043942 mRNA downstream 95634 18177281 ~ 18286822 (-) False XLOC_022258
TCONS_00043940 mRNA downstream 252192 18118535 ~ 18130264 (-) False XLOC_022257
TCONS_00043933 mRNA downstream 324498 18033219 ~ 18057958 (-) False XLOC_022254
TCONS_00043946 mRNA upstream 4438 18386989 ~ 18415872 (-) True XLOC_022261
TCONS_00043947 mRNA upstream 175658 18558209 ~ 18567088 (-) False XLOC_022262
TCONS_00043948 mRNA upstream 178315 18560866 ~ 18568522 (-) True XLOC_022262
TCONS_00043949 mRNA upstream 186740 18569291 ~ 18572685 (-) False XLOC_022263
TCONS_00043950 mRNA upstream 186757 18569308 ~ 18572521 (-) False XLOC_022263
TCONS_00043939 other downstream 319157 18063173 ~ 18063299 (-) True XLOC_022255
TCONS_00043921 other downstream 699524 17682818 ~ 17682932 (-) True XLOC_022248
TCONS_00043901 other downstream 1206238 17176104 ~ 17176218 (-) True XLOC_022240
TCONS_00043900 other downstream 1336072 17044294 ~ 17046384 (-) True XLOC_022239
TCONS_00043898 other downstream 1397862 16983777 ~ 16984594 (-) True XLOC_022237
TCONS_00043958 other upstream 227465 18610016 ~ 18611010 (-) True XLOC_022266
TCONS_00043959 other upstream 228576 18611127 ~ 18612421 (-) True XLOC_022267
TCONS_00043965 other upstream 376991 18759542 ~ 18777957 (-) True XLOC_022270
TCONS_00043968 other upstream 486865 18869416 ~ 18870756 (-) False XLOC_022272
TCONS_00043969 other upstream 488039 18870590 ~ 18884382 (-) False XLOC_022272