RNA id: TCONS_00043951


Basic Information

Item Value
RNA id TCONS_00043951
length 553
lncRNA type retained_intron
GC content 0.46
exon number 3
gene id XLOC_022263
representative True

Chromosome Information

Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 18569291 ~ 18572685 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTTTCATTGGGTGAACAGACCCGAGTACTGCTCTCTTTTTAGGTTTGAGTGAGTAGAGATTCAACCAACAGCCCGGAGATCAACATGAAGCTAGTATTAACAACTCTTCTGGCTCTTTGTCTGAGCTTCTGTGCAGGTAATTAGCTTTTCCGTTAATTTAATATTGCACTCTTCATTCAGGTATTCGCGAACGATGAGGTGTCACATGCTAACGTACAGTAAATAAGTTCCGTTTTCTTTCTCTGTCGTCTAACGTTACTTGATTTCATTAAGCTGTTATTTTAGATAATGTATGCGTATTTTCCTCCTCAGCTGAGACTTGCACAGACCCGGTGATTTCTCCGTCTTCATACACGACGACAGACGCGCTCATCTCCTCCGAGACTGTGTTCATCGTTGAACTGAGTCTGGCGTGTGCAAACGGGGCTCAGAGCGTCGCCCTGTACGCTGATGTCAATGGCAAGCAGTTCCCTGTGACCAGAGGCCAAGATGTTGGCAAATACCAGGTGTCATGGAGTGTTCCTCATAAGCAGGCCAGCTCAGGCACATATCA

Function

GO:

id name namespace
GO:0071391 cellular response to estrogen stimulus biological_process
GO:0005783 endoplasmic reticulum cellular_component
GO:0012505 endomembrane system cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG:

id description
ko04141 Protein processing in endoplasmic reticulum

ZFIN:

id description
ZDB-GENE-030131-4900 Acts upstream of or within cellular response to estrogen stimulus. Predicted to be located in endoplasmic reticulum and membrane. Predicted to be integral component of membrane. Predicted to be active in endomembrane system. Is expressed in several structures, including axis; endocrine system; hatching gland; notochord; and polster. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation Iy. Orthologous to human SSR4 (signal sequence receptor subunit 4).

Ensembl:

ensembl_id ENSDART00000133493

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00044984 lncRNA downstream 179369 18386787 ~ 18392290 (-) False XLOC_022261
TCONS_00044983 lncRNA downstream 186491 18382297 ~ 18385168 (-) False XLOC_022260
TCONS_00044982 lncRNA downstream 186492 18382297 ~ 18385167 (-) False XLOC_022260
TCONS_00043941 lncRNA downstream 449004 18119854 ~ 18122655 (-) True XLOC_022257
TCONS_00044726 lncRNA downstream 497240 18073715 ~ 18074419 (-) True XLOC_022256
TCONS_00043952 lncRNA upstream 1576 18574221 ~ 18578522 (-) False XLOC_022264
TCONS_00044727 lncRNA upstream 296572 18869217 ~ 18870954 (-) False XLOC_022272
TCONS_00044985 lncRNA upstream 296771 18869416 ~ 18884382 (-) False XLOC_022272
TCONS_00043972 lncRNA upstream 332029 18904674 ~ 18913072 (-) False XLOC_022273
TCONS_00044986 lncRNA upstream 332029 18904674 ~ 18913159 (-) False XLOC_022273
TCONS_00043948 mRNA downstream 3137 18560866 ~ 18568522 (-) True XLOC_022262
TCONS_00043947 mRNA downstream 4571 18558209 ~ 18567088 (-) False XLOC_022262
TCONS_00043946 mRNA downstream 155787 18386989 ~ 18415872 (-) True XLOC_022261
TCONS_00043944 mRNA downstream 190298 18372048 ~ 18381361 (-) True XLOC_022259
TCONS_00043943 mRNA downstream 284041 18180899 ~ 18287618 (-) True XLOC_022258
TCONS_00043953 mRNA upstream 1629 18574274 ~ 18597704 (-) False XLOC_022264
TCONS_00043954 mRNA upstream 2074 18574719 ~ 18595020 (-) False XLOC_022264
TCONS_00043955 mRNA upstream 2074 18574719 ~ 18595025 (-) False XLOC_022264
TCONS_00043956 mRNA upstream 2076 18574721 ~ 18597709 (-) True XLOC_022264
TCONS_00043957 mRNA upstream 30542 18603187 ~ 18609475 (-) True XLOC_022265
TCONS_00043945 other downstream 189108 18382456 ~ 18382551 (-) True XLOC_022260
TCONS_00043939 other downstream 508360 18063173 ~ 18063299 (-) True XLOC_022255
TCONS_00043921 other downstream 888727 17682818 ~ 17682932 (-) True XLOC_022248
TCONS_00043901 other downstream 1395441 17176104 ~ 17176218 (-) True XLOC_022240
TCONS_00043900 other downstream 1525275 17044294 ~ 17046384 (-) True XLOC_022239
TCONS_00043958 other upstream 37371 18610016 ~ 18611010 (-) True XLOC_022266
TCONS_00043959 other upstream 38482 18611127 ~ 18612421 (-) True XLOC_022267
TCONS_00043965 other upstream 186897 18759542 ~ 18777957 (-) True XLOC_022270
TCONS_00043968 other upstream 296771 18869416 ~ 18870756 (-) False XLOC_022272
TCONS_00043969 other upstream 297945 18870590 ~ 18884382 (-) False XLOC_022272

Expression Profile

//