RNA id: TCONS_00062340


Basic Information

Item Value
RNA id TCONS_00062340
length 645
RNA type mRNA
GC content 0.51
exon number 4
gene id XLOC_031827
representative True

Chromosome Information

Item Value
chromosome id NC_007117.7
NCBI id CM002890.2
chromosome length 60270059
location 7444899 ~ 7452559 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ACACAAAGGACTCGCAGCTTTAAGGACGAAGTAAAACATTGAATCATGGGGAATATTTTTGGCAATCTGCTGAAGAGTCTGATAGGAAAGAAGGAGATGAGAATTCTGATGGTTGGACTTGATGCTGCTGGTAAAACCACCATCCTTTACAAACTGAAGCTGGGAGAGATCGTCACCACCATCCCAACCATCGGCTTTAATGTGGAGACAGTGGAGTACAAGAACATCAGCTTCACTGTGTGGGATGTTGGTGGTCAGGATAAAATCAGGCCGCTCTGGAGACACTACTTTCAAAACACACAGGGTCTGATCTTTGTGGTGGACAGCAACGACCGGGAGCGGGTGAACGAGGCCCGAGAGGAGTTGATGAGGATGCTCGCAGAAGACGAACTTCGTGACGCTGTTCTTCTCGTCTTCGCAAACAAACAGGATCTGCCAAACGCTATGAACGCTGCCGAGATCACAGATAAACTGGGCCTTCACTCGCTCCGCCATCGTAACTGGTATATACAGGCGACCTGCGCGACCAGCGGCGACGGCCTGTACGAGGGACTCGACTGGCTCGCCAACCAGCTCAAGAACAAGAAGTGAGGCCGGGTTTTCATTATGCGGCGCTTTGGGAACGGGTGGGATTAATTTGGCCTT

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0016192 vesicle-mediated transport biological_process
GO:0005886 plasma membrane cellular_component
GO:0005737 cytoplasm cellular_component
GO:0005525 GTP binding molecular_function
GO:0000166 nucleotide binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030616-356 Predicted to enable GTP binding activity. Predicted to be involved in intracellular protein transport and vesicle-mediated transport. Predicted to be active in cytoplasm and plasma membrane. Orthologous to human ARF3 (ADP ribosylation factor 3).

Ensembl:

ensembl_id ENSDART00000053775

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00062339 lncRNA upstream 9199 7429311 ~ 7435700 (+) True XLOC_031826
TCONS_00064806 lncRNA upstream 236270 7207593 ~ 7208629 (+) True XLOC_031820
TCONS_00062325 lncRNA upstream 544216 6894228 ~ 6900683 (+) True XLOC_031816
TCONS_00062317 lncRNA upstream 636559 6802528 ~ 6808340 (+) False XLOC_031814
TCONS_00062315 lncRNA upstream 644641 6799291 ~ 6800258 (+) True XLOC_031813
TCONS_00062351 lncRNA downstream 198168 7650727 ~ 7652412 (+) True XLOC_031831
TCONS_00062354 lncRNA downstream 637864 8090423 ~ 8093799 (+) False XLOC_031833
TCONS_00064807 lncRNA downstream 812205 8264764 ~ 8271403 (+) True XLOC_031837
TCONS_00062364 lncRNA downstream 886712 8339271 ~ 8346941 (+) True XLOC_031839
TCONS_00064808 lncRNA downstream 997752 8450311 ~ 8453642 (+) True XLOC_031840
TCONS_00062338 mRNA upstream 17387 7421898 ~ 7427512 (+) True XLOC_031825
TCONS_00062337 mRNA upstream 29556 7414215 ~ 7415343 (+) True XLOC_031824
TCONS_00062336 mRNA upstream 54441 7322587 ~ 7390458 (+) True XLOC_031823
TCONS_00062334 mRNA upstream 164600 7249563 ~ 7280299 (+) False XLOC_031822
TCONS_00062342 mRNA downstream 13664 7466223 ~ 7531427 (+) False XLOC_031829
TCONS_00062344 mRNA downstream 37595 7490154 ~ 7529487 (+) False XLOC_031829
TCONS_00062346 mRNA downstream 54831 7507390 ~ 7511762 (+) True XLOC_031829
TCONS_00062347 mRNA downstream 81042 7533601 ~ 7551140 (+) True XLOC_031830
TCONS_00062349 mRNA downstream 100526 7553085 ~ 7658285 (+) False XLOC_031831
TCONS_00062324 other upstream 564850 6879927 ~ 6880049 (+) True XLOC_031817
TCONS_00062321 other upstream 612278 6832046 ~ 6832621 (+) True XLOC_031815
TCONS_00062305 other upstream 1171422 6271867 ~ 6273477 (+) True XLOC_031808
TCONS_00062300 other upstream 1228989 6215794 ~ 6215910 (+) True XLOC_031807
TCONS_00062297 other upstream 1760604 5684181 ~ 5684295 (+) True XLOC_031803
TCONS_00062341 other downstream 796 7453355 ~ 7453831 (+) True XLOC_031828
TCONS_00062343 other downstream 13714 7466273 ~ 7472497 (+) False XLOC_031829
TCONS_00062345 other downstream 47569 7500128 ~ 7505016 (+) False XLOC_031829
TCONS_00062355 other downstream 638018 8090577 ~ 8093799 (+) True XLOC_031833
TCONS_00062362 other downstream 861964 8314523 ~ 8321969 (+) False XLOC_031838

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000024_04900693_04903891.mRNA True 1464 mRNA 0.44 4 CI01000024 4899850 ~ 4903966 (-)
bowfin (Amia calva) TU65001 True 766 TUCP 0.60 5 CM030126.1 13257706 ~ 13261822 (-)
tiger barb (Puntius tetrazona) TU65001 True 1588 lncRNA 0.30 2 NC_056704.1 9082625 ~ 9084953 (+)