RNA id: TCONS_00069748


Basic Information

Item Value
RNA id TCONS_00069748
length 561
RNA type processed_transcript
GC content 0.48
exon number 4
gene id XLOC_035569
representative True

Chromosome Information

Item Value
chromosome id NC_007119.7
NCBI id CM002892.2
chromosome length 54304671
location 19504011 ~ 19512270 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TTTCCGGCCAGCTCAGCGCACCACAGAGGAGTATTTTGGAGCTCTAATCCAGACTGAGACATTTGTTTTCCAGCTGTAAACACTTCACAAACACCTGCCGTGCGTAAATCTGACATTACAGAAAAATGGTGCTGTTGACGATGATCGCGCGGCTGGCGGACGGACTCCCGCTTGCGGCTTCAATGCAGGAGGACGAGCAGATGGGTCGAGATCTGCAGCAATATCAGAGCCAGGCCAAACAGCTCTTCCGAAAACTAAATGAACAGAGTCCCAACCGATGCACCTTAGAGGCAGGATCTATGTCCTTTCACTATGTCATAGAGAAGGGCGTTTGCTATTTGGTTCTCTGTGAGGCCGGGTTTCCTAAAAAGCTAGCGTTTGCTTATCTGGAAGATCTACAGGCCGAATTTCATGAACAGCACGGCAAAAAGATACATACATTCAGAAAACCAAAAAGTCCTACATTGACAGCAGAGCACGCAGGAACCTGAGCAACATTAACACAGAGCTACAGGATGTACAGAGGATCATGGTGGCCAATATTGAAGAAGTCCTGCAGCG

Function

GO:

id name namespace
GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport biological_process
GO:0006890 retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum biological_process
GO:0048280 vesicle fusion with Golgi apparatus biological_process
GO:0016192 vesicle-mediated transport biological_process
GO:0015031 protein transport biological_process
GO:0033116 endoplasmic reticulum-Golgi intermediate compartment membrane cellular_component
GO:0005783 endoplasmic reticulum cellular_component
GO:0005789 endoplasmic reticulum membrane cellular_component
GO:0005793 endoplasmic reticulum-Golgi intermediate compartment cellular_component
GO:0005794 Golgi apparatus cellular_component
GO:0042470 melanosome cellular_component
GO:0000139 Golgi membrane cellular_component
GO:0012507 ER to Golgi transport vesicle membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0031201 SNARE complex cellular_component
GO:0005484 SNAP receptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-5488 Predicted to enable SNAP receptor activity. Predicted to be involved in endoplasmic reticulum to Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to endoplasmic reticulum; and vesicle fusion with Golgi apparatus. Predicted to act upstream of or within protein transport and vesicle-mediated transport. Predicted to be located in several cellular components, including Golgi apparatus; endoplasmic reticulum-Golgi intermediate compartment membrane; and melanosome. Predicted to be integral component of membrane. Predicted to be part of SNARE complex. Predicted to be active in bounding membrane of organelle; endoplasmic reticulum membrane; and endoplasmic reticulum-Golgi intermediate compartment. Orthologous to human SEC22B (SEC22 homolog B, vesicle trafficking protein).

Ensembl:

ensembl_id ENSDART00000172109

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00072176 lncRNA upstream 271352 19227835 ~ 19232675 (+) True XLOC_035566
TCONS_00071923 lncRNA upstream 770433 18709974 ~ 18733594 (+) True XLOC_035563
TCONS_00071922 lncRNA upstream 1091999 18410984 ~ 18412028 (+) True XLOC_035556
TCONS_00072175 lncRNA upstream 1535793 17962829 ~ 17968234 (+) True XLOC_035551
TCONS_00072174 lncRNA upstream 2096947 17368041 ~ 17407080 (+) True XLOC_035546
TCONS_00069750 lncRNA downstream 5116 19514357 ~ 19516262 (+) False XLOC_035570
TCONS_00069751 lncRNA downstream 7362 19516603 ~ 19520119 (+) True XLOC_035570
TCONS_00072177 lncRNA downstream 154213 19663454 ~ 19715690 (+) False XLOC_035573
TCONS_00072178 lncRNA downstream 154219 19663460 ~ 19715690 (+) False XLOC_035573
TCONS_00072180 lncRNA downstream 154345 19663586 ~ 19715690 (+) False XLOC_035573
TCONS_00069744 mRNA upstream 3673 19489854 ~ 19500354 (+) False XLOC_035568
TCONS_00069745 mRNA upstream 3964 19489928 ~ 19500063 (+) True XLOC_035568
TCONS_00069743 mRNA upstream 144193 19356072 ~ 19359834 (+) True XLOC_035567
TCONS_00069741 mRNA upstream 663333 18830759 ~ 18840694 (+) True XLOC_035564
TCONS_00069739 mRNA upstream 856664 18624658 ~ 18647363 (+) True XLOC_035561
TCONS_00069749 mRNA downstream 5053 19514294 ~ 19520341 (+) False XLOC_035570
TCONS_00069752 mRNA downstream 39744 19548985 ~ 19619792 (+) True XLOC_035571
TCONS_00069753 mRNA downstream 112270 19621511 ~ 19638362 (+) False XLOC_035572
TCONS_00069754 mRNA downstream 112490 19621731 ~ 19638362 (+) False XLOC_035572
TCONS_00069755 mRNA downstream 115348 19624589 ~ 19638362 (+) True XLOC_035572
TCONS_00069742 other upstream 480650 19023261 ~ 19023377 (+) True XLOC_035565
TCONS_00069740 other upstream 833665 18670237 ~ 18670362 (+) True XLOC_035562
TCONS_00069707 other upstream 2406962 17087060 ~ 17097065 (+) True XLOC_035542
TCONS_00069704 other upstream 2430656 17069577 ~ 17073371 (+) False XLOC_035540
TCONS_00069701 other upstream 2693774 16772174 ~ 16810253 (+) True XLOC_035537
TCONS_00069759 other downstream 442492 19951733 ~ 19952380 (+) False XLOC_035578
TCONS_00069760 other downstream 442536 19951777 ~ 19952379 (+) True XLOC_035578
TCONS_00069761 other downstream 449244 19958485 ~ 19959118 (+) False XLOC_035579
TCONS_00069762 other downstream 449271 19958512 ~ 19959117 (+) True XLOC_035579
TCONS_00069763 other downstream 455982 19965223 ~ 19965872 (+) False XLOC_035580

Expression Profile

//