G178907


Basic Information

Item Value
gene id G178907
gene name NA
gene type non-coding
species eurasian perch (Perca fluviatilis)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_053128.1
NCBI id CM020925.1
chromosome length 37416781
location 30124638 ~ 30125211 (+)
genome version GENO_Pfluv_1.0_2020_eurasian_perch_Genome

Sequence

>TU242189
cctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcctgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcccgttcttctttatctaaacccaactgtcctgttcttctttacctaaacccaactgtcccgttcttctttacctaaacccaactgtcctgttcttctt

Function

GO:

id name namespace
GO:0005911 cell-cell junction cellular_component
GO:0005921 gap junction cellular_component
GO:0005922 connexin complex cellular_component
GO:0030054 cell junction cellular_component
GO:0005198 structural molecule activity molecular_function
GO:0005212 structural constituent of eye lens molecular_function

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU242189 True 259 lncRNA 0.44 3 30124638 30125211

Neighbor

gene id symbol gene type direction distance location
nudcd3 nudcd3 coding upstream 9092 30108774 ~ 30115546 (+)
gnsb gns,LOC104931705,LOC103374629 coding upstream 36618 30061600 ~ 30088020 (+)
il1b NA coding upstream 159390 29951452 ~ 29965248 (+)
LOC120545406 cnnm3 coding upstream 199373 29895677 ~ 29925265 (+)
LOC120545067 cnnm4,LOC103473218,LOC107395816 coding upstream 241717 29846353 ~ 29882921 (+)
ogdhb ogdh coding downstream 65059 30190270 ~ 30228617 (+)
ppiab ppia,LOC104934128,LOC104948019 coding downstream 191248 30316459 ~ 30322003 (+)
LOC120545413 NA coding downstream 208096 30333307 ~ 30335753 (+)
LOC120545426 LOC103129635,LOC106953379,LOC106904245,LOC107386157,LOC105916632,LOC103470758,LOC100699155,LOC102206240,LOC102305468 coding downstream 213499 30338710 ~ 30344803 (+)
ddx56 ddx56 coding downstream 256770 30381981 ~ 30399109 (+)
G178902 NA non-coding upstream 16083 30106993 ~ 30108555 (+)
G178854 NA non-coding upstream 17916 29839836 ~ 30106722 (+)
G178882 NA non-coding upstream 101159 30023031 ~ 30023479 (+)
G178859 NA non-coding upstream 129122 29925734 ~ 29995516 (+)
LOC120545430 NA non-coding upstream 166249 29956270 ~ 29958389 (+)
G178910 NA non-coding downstream 31154 30156365 ~ 30156778 (+)
G178918 NA non-coding downstream 110007 30235218 ~ 30275572 (+)
G178933 NA non-coding downstream 239549 30364760 ~ 30368909 (+)
G178934 NA non-coding downstream 249603 30374814 ~ 30375165 (+)
G178950 NA non-coding downstream 298742 30423953 ~ 30430650 (+)
G178881 NA other upstream 102421 30021319 ~ 30022217 (+)
LOC120545429 LOC104948058 other upstream 328813 29793804 ~ 29795825 (+)
G178845 NA other upstream 374343 29742623 ~ 29750295 (+)
rasgrf2a NA other upstream 457407 29601531 ~ 29667231 (+)
G178529 NA other upstream 1032312 29084949 ~ 29092326 (+)
zmiz2 zmiz2 other downstream 134155 30259366 ~ 30310894 (+)
LOC120545414 LOC106676976 other downstream 198901 30324112 ~ 30331614 (+)
G179407 NA other downstream 1262536 31387747 ~ 31480094 (+)
LOC120545154 hapln1,LOC101070352,LOC100699000,LOC101480665 other downstream 1440034 31565245 ~ 31653583 (+)
LOC120544927 NA other downstream 1686518 31811729 ~ 31832260 (+)

Expression


Co-expression Network