LOC113531684


Basic Information

Item Value
gene id LOC113531684
gene name NA
gene type non-coding
species striped catfish (Pangasianodon hypophthalmus)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_047621.1
NCBI id CM018567.1
chromosome length 18889892
location 13915364 ~ 13915497 (-)
genome version GENO_Phyp_1.0_2019_striped_catfish_Genome

Sequence

>XR_003403286.1
CCTGAGGTCTATCCCGACTGGCCCCTCACAGTAGAGCCGTGTCGTTGGAAATGCCTCAAAGATGAACGCTGTAGTATAGCTTTACCCATAGTGTTACTGCCATTAACTCTGTGGGCAAACGCTGCAGGACAAAC

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0007498 mesoderm development biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0009888 tissue development biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0010468 regulation of gene expression biological_process
GO:0007389 pattern specification process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
XR_003403286.1 True 134 ncRNA 0.51 1 13915364 13915497

Neighbor

gene id symbol gene type direction distance location
castor2 gatsl2,LOC107685562,LOC107595468,LOC107587690,LOC107681899 coding downstream 6907 13892212 ~ 13908457 (-)
polr2j polr2j,LOC107587688,LOC107595521 coding downstream 53209 13859139 ~ 13862155 (-)
alkbh4 alkbh4 coding downstream 57246 13855219 ~ 13858118 (-)
lrwd1 lrwd1 coding downstream 63081 13843178 ~ 13852283 (-)
bckdk bckdk,LOC107685622,LOC107681895,LOC106603456 coding downstream 74030 13823386 ~ 13841334 (-)
LOC113531503 doc2b,LOC107685552,LOC107681901,LOC106603746 coding upstream 6243 13921740 ~ 13989353 (-)
LOC113531468 LOC108260357,LOC108428416,LOC107714896,LOC107691814,LOC107572424 coding upstream 141908 14057405 ~ 14070855 (-)
tmem248 tmem248,LOC107714897,LOC107572429,LOC107691774 coding upstream 159044 14074541 ~ 14085085 (-)
lig3 lig3,LOC107691772,LOC107710722,LOC107689374 coding upstream 178067 14093564 ~ 14103564 (-)
tmem132e tmem132e,LOC107691770,LOC107689377 coding upstream 255805 14171302 ~ 14409340 (-)
LOC117596230 NA non-coding downstream 38558 13876017 ~ 13876806 (-)
G386849 NA non-coding downstream 61309 13853837 ~ 13854055 (-)
G386845 pex12,LOC107587685,LOC107681885,LOC107710733 non-coding downstream 87510 13809601 ~ 13827854 (-)
G386814 NA non-coding downstream 243224 13671223 ~ 13672140 (-)
G386763 NA non-coding downstream 392042 13523086 ~ 13523322 (-)
G386873 NA non-coding upstream 14990 13930487 ~ 13930698 (-)
G387048 NA non-coding upstream 423819 14339316 ~ 14340196 (-)
G387277 NA non-coding upstream 955022 14870519 ~ 14877458 (-)
G387434 NA non-coding upstream 1283109 15198606 ~ 15204665 (-)
LOC117596201 NA non-coding upstream 1305283 15220780 ~ 15234734 (-)
selenow1 LOC103044489 other downstream 234839 13616122 ~ 13680525 (-)
garnl3 garnl3,LOC107700942 other downstream 1024069 12807201 ~ 12891295 (-)
LOC113531030 NA other downstream 2216820 11691234 ~ 11698544 (-)
map1b map1b,LOC107597920 other downstream 2287678 11546309 ~ 11627686 (-)
G384960 NA other downstream 2831423 11078712 ~ 11083941 (-)
ccdc84 ccdc84 other upstream 1001165 14916662 ~ 14923390 (-)
nrgna NA other upstream 1103396 15018893 ~ 15026869 (-)
gltpd2 LOC108260402 other upstream 1966841 15882338 ~ 15888059 (-)
LOC113531235 NA other upstream 2447997 16363494 ~ 16380787 (-)
fxyd2 NA other upstream 2842743 16758240 ~ 16763476 (-)

Expression


Co-expression Network