G40403



Basic Information


Item Value
gene id G40403
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000005
NCBI id null
chromosome length 7630583
location 6993317 ~ 7090894 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU45812
GGGGTGGCATGCTTGAAAGACAGGCCAACAAAGGTGCTGGAAAATGGCAGGCTCTCACCTGTGCGAGTGCAATGGACTACGTTTGATCTGGCATACTGACTGAAGGATTGCCTGGTGATTTTTGAGGCCTTTTATCAGTGGACTATCAACTATTCTCCTTCTGGGATTATTGGAGGATTATTTTTTCCTCTTCAGTGGTTTGCCTTAGGAATCCAGGAATCCCTGAGAAGTTAATGTGGGTGAGACTGTTGGGTTTTTTTTTTG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU45812 True 264 lncRNA 0.42 2 6993317 7090894

Neighbor


gene id symbol gene type direction distance location
CI01000005_06815976_06894322 SLIT1A, SLIT1 coding downstream 98732 6815378 ~ 6894585 (-)
CI01000005_06772433_06793278 NVL coding downstream 200039 6772433 ~ 6793278 (-)
CI01000005_06765592_06772165 NA coding downstream 221152 6765273 ~ 6772165 (-)
CI01000005_06721142_06724797 NA coding downstream 268484 6720908 ~ 6724833 (-)
CI01000005_06655061_06664135 NA coding downstream 328977 6654881 ~ 6664340 (-)
CI01000005_07093538_07094533 NA coding upstream 2588 7093482 ~ 7094569 (-)
CI01000005_07111233_07112234 NA coding upstream 19828 7110722 ~ 7112266 (-)
CI01000005_07143500_07144465 NA coding upstream 52588 7143482 ~ 7144565 (-)
CI01000005_07190084_07218097 NA coding upstream 98702 7189596 ~ 7218133 (-)
CI01000005_07355833_07360372 NA coding upstream 264939 7355833 ~ 7360372 (-)
G40382 NA non-coding downstream 47745 6943111 ~ 6945572 (-)
G40379 NA non-coding downstream 54023 6939091 ~ 6939294 (-)
G40378 NA non-coding downstream 54663 6938427 ~ 6938654 (-)
G40349 NA non-coding downstream 239300 6753816 ~ 6754017 (-)
G40316 NA non-coding downstream 312068 6680036 ~ 6681249 (-)
G40472 NA non-coding upstream 64467 7155361 ~ 7155615 (-)
G40497 NA non-coding upstream 129117 7220011 ~ 7220359 (-)
G40499 NA non-coding upstream 131713 7222607 ~ 7222893 (-)
G40503 NA non-coding upstream 140712 7231606 ~ 7231852 (-)
G40518 NA non-coding upstream 192827 7283721 ~ 7284935 (-)
CI01000005_06481721_06483251 NA other downstream 509828 6481355 ~ 6483265 (-)
G39515 NA other downstream 1158778 5833792 ~ 5834539 (-)
G38415 NA other downstream 2592207 4381238 ~ 4401110 (-)
G38510 NA other downstream 2787109 4204845 ~ 4206208 (-)
CI01000005_01883894_01899867 NA other downstream 5104041 1883222 ~ 1899867 (-)
G40487 NA other upstream 104901 7195795 ~ 7196428 (-)
G40540 NA other upstream 435327 7526221 ~ 7532148 (-)

Expression



Co-expression Network