G187928


Basic Information

Item Value
gene id G187928
gene name NA
gene type non-coding
species mexican tetra (Astyanax mexicanus)
category of species ornamental fish

Chromosome Information

Item Value
chromosome id NC_035918.1
NCBI id CM008321.1
chromosome length 32506130
location 7231122 ~ 7231844 (-)
genome version Astyanax_mexicanus-2.0_2017_mexican_tetra_Genome

Sequence

>TU254859
gtgtagtgatgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgatgaactctgaagctacatgaagtttggaggtgttgtagtgatgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctgaagctacatgaagtttggaggagtgtagtgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctgaagctacatgaagtttggaggagtgtagtgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctgaagctacatgaagtttggaggtgtgtagtgatgaactctga

Function

GO: NA

KEGG:

id description
ko04610 Complement and coagulation cascades

RNA

RNA id representative length rna type GC content exon number start site end site
TU254859 True 515 lncRNA 0.42 2 7231122 7231844

Neighbor

gene id symbol gene type direction distance location
LOC103037403 NA coding downstream 25731 7197200 ~ 7205391 (-)
hp1bp3 hp1bp3 coding downstream 165036 7053226 ~ 7066086 (-)
sh2d5 sh2d5 coding downstream 180821 7033104 ~ 7050301 (-)
kif17 kif17,LOC108438632 coding downstream 200095 7007447 ~ 7031027 (-)
sox13 sox13 coding downstream 282168 6897991 ~ 6948954 (-)
LOC103035242 NA coding upstream 144715 7376559 ~ 7378591 (-)
LOC103034269 LOC108438618,LOC108414439 coding upstream 202300 7434144 ~ 7455982 (-)
LOC103022868 rap1b,rap1a,rap1ab,LOC105901888,LOC106566052,LOC107560426,LOC107742898 coding upstream 889893 8121737 ~ 8139529 (-)
LOC103046978 LOC108414459 coding upstream 1056074 8287918 ~ 8326276 (-)
LOC111195367 LOC106511942 coding upstream 2504504 9736348 ~ 9738497 (-)
G187881 NA non-coding downstream 42670 7188078 ~ 7188452 (-)
G187880 NA non-coding downstream 43084 7187790 ~ 7188038 (-)
G187878 NA non-coding downstream 47069 7183826 ~ 7184053 (-)
G187875 NA non-coding downstream 75773 7153083 ~ 7155349 (-)
LOC111195364 NA non-coding downstream 100343 7106200 ~ 7130779 (-)
G187933 acot8,LOC107730625,LOC107670930 non-coding upstream 118167 7350011 ~ 7353303 (-)
G187931 srsf6,LOC107654800,LOC107722005,LOC103156038,LOC108254894 non-coding upstream 122403 7354247 ~ 7361214 (-)
G187965 NA non-coding upstream 225934 7457778 ~ 7460141 (-)
G187968 NA non-coding upstream 233878 7465722 ~ 7465984 (-)
G187969 NA non-coding upstream 235249 7467093 ~ 7467324 (-)
pdrg1 pdrg1 other downstream 37870 7188616 ~ 7193252 (-)
LOC111195363 snrpe other downstream 248282 6977651 ~ 6982840 (-)
svbp svbp other downstream 1708201 5518793 ~ 5522921 (-)
phf13 phf13 other downstream 1725375 5493412 ~ 5505747 (-)
vamp3 vamp3,LOC107582408,LOC107751179 other downstream 2241864 4974228 ~ 4989258 (-)
G187946 mybl2,mybl2b other upstream 156553 7388397 ~ 7391026 (-)
ghrh ghrh,LOC103034597,LOC108438619 other upstream 177278 7409122 ~ 7419806 (-)
LOC111195437 NA other upstream 2719240 9951084 ~ 9956317 (-)
G188898 NA other upstream 3758973 10990817 ~ 10991394 (-)
G189055 NA other upstream 4812069 12043913 ~ 12044293 (-)

Expression


Co-expression Network