G153299


Basic Information

Item Value
gene id G153299
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 2875591 ~ 2875796 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU174089
CAGCTTTCTTTTGGCTGCAATATTATCATTGCATCAAACCGACGCTTGACACCCTACAGCCAAGTAGCACGTCCGTTCTGCGCCTGCATAAGAAGAAATGCCTTTCTGTACCAGCAGGTGGCAGTAGCTGAACAGCCAATCAGAATGATCAGATGGCCCGACTGACCAACGAGCTCCGACGCCGATTCAACATGTCGAATCGGCCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU174089 True 206 lncRNA 0.51 1 2875591 2875796

Neighbor

gene id symbol gene type direction distance location
CI01000029_02837412_02857934 NA coding downstream 17651 2836763 ~ 2857940 (-)
CI01000029_02764957_02770946 HSDL1 coding downstream 104198 2764957 ~ 2771393 (-)
CI01000029_02762066_02762926 CX32.3 coding downstream 111823 2761607 ~ 2763768 (-)
CI01000029_02753815_02761288 CX28.9 coding downstream 114064 2753748 ~ 2761527 (-)
CI01000029_02742245_02743081 CX32.2 coding downstream 131367 2741953 ~ 2744224 (-)
CI01000029_02957572_02962601 NA coding upstream 81631 2957427 ~ 2963354 (-)
CI01000029_03382508_03395312 NA coding upstream 506554 3382350 ~ 3395312 (-)
CI01000029_03397097_03444565 SLC35F1 coding upstream 520343 3396139 ~ 3444565 (-)
CI01000029_03503783_03509429 NUS1 coding upstream 627867 3503663 ~ 3509429 (-)
CI01000029_03534096_03563671 NA coding upstream 658256 3534052 ~ 3563671 (-)
G153289 NA non-coding downstream 25217 2850037 ~ 2850374 (-)
G153288 NA non-coding downstream 26005 2849367 ~ 2849586 (-)
G153287 NA non-coding downstream 26738 2848603 ~ 2848853 (-)
G153286 NA non-coding downstream 27152 2848204 ~ 2848439 (-)
G153285 NA non-coding downstream 35930 2839378 ~ 2839661 (-)
G153333 NA non-coding upstream 37136 2912932 ~ 2914231 (-)
G153373 NA non-coding upstream 173263 3049059 ~ 3049329 (-)
G153985 NA non-coding upstream 434914 3310710 ~ 3310981 (-)
G153952 NA non-coding upstream 472585 3348381 ~ 3358355 (-)
G154017 NA non-coding upstream 698268 3574064 ~ 3574456 (-)
CI01000029_02589994_02592379 NA other downstream 282789 2587549 ~ 2592379 (-)
CI01000029_01293143_01293964 BATF3 other downstream 1581468 1292249 ~ 1294123 (-)
G153891 NA other upstream 372981 3248777 ~ 3286554 (-)
CI01000029_03698769_03707177 NA other upstream 830427 3698572 ~ 3707883 (-)
CI01000029_04460778_04463540 FKBP1B other upstream 1584547 4460159 ~ 4463540 (-)
G154415 NA other upstream 2110312 4986108 ~ 4990990 (-)
G156542 NA other upstream 4294571 7170367 ~ 7170951 (-)

Expression


Co-expression Network