G154046


Basic Information

Item Value
gene id G154046
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000029
NCBI id null
chromosome length 9486966
location 3687852 ~ 3688128 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU174930
GAAATCTGATGTCTCAGTGAGGCCTCTATTGACGGCAAGATAATTAACACTTTCAGATGCCCAGAAAGGAACTAAAGACATATTTAAAACAGTTCATGTGACTACAATGGTTCAACCTTAATGTTATGAAGCGTCGAGAATACTTTTTGTGCGGCAAAAAAACAAAATAACTTTATTCAACAATATCTAGTGATGGGCGATTTCAAAACACTGCTTCATGAAGCTTCGAAGCTTTACGAATCTTGTTTCGAATCAGTTGTTCAGAGCGTATCAAACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU174930 True 277 lncRNA 0.36 1 3687852 3688128

Neighbor

gene id symbol gene type direction distance location
CI01000029_03625037_03636215 RFX6 coding downstream 50819 3624704 ~ 3637033 (-)
CI01000029_03590053_03594170 VGLL2, VGLL2A coding downstream 92948 3589653 ~ 3594904 (-)
CI01000029_03534096_03563671 NA coding downstream 124181 3534052 ~ 3563671 (-)
CI01000029_03503783_03509429 NUS1 coding downstream 178423 3503663 ~ 3509429 (-)
CI01000029_03397097_03444565 SLC35F1 coding downstream 243287 3396139 ~ 3444565 (-)
CI01000029_03698769_03707177 NA coding upstream 10444 3698572 ~ 3707883 (-)
CI01000029_03723621_03726874 NA coding upstream 35059 3723187 ~ 3727070 (-)
CI01000029_03746973_03752660 PLG coding upstream 58808 3746936 ~ 3752660 (-)
CI01000029_03769171_03775841 UNC93A coding upstream 80659 3768787 ~ 3775841 (-)
CI01000029_03799874_03822017 NA coding upstream 111727 3799855 ~ 3822181 (-)
G154040 NA non-coding downstream 53309 3633985 ~ 3634543 (-)
G154017 NA non-coding downstream 113396 3574064 ~ 3574456 (-)
G153952 NA non-coding downstream 329497 3348381 ~ 3358355 (-)
G153985 NA non-coding downstream 376871 3310710 ~ 3310981 (-)
G153373 NA non-coding downstream 638523 3049059 ~ 3049329 (-)
G154047 NA non-coding upstream 99 3688227 ~ 3688470 (-)
G154057 NA non-coding upstream 48103 3736231 ~ 3740719 (-)
G154137 NA non-coding upstream 314048 4002176 ~ 4002475 (-)
G154140 NA non-coding upstream 368609 4056737 ~ 4057258 (-)
G154144 NA non-coding upstream 374054 4062182 ~ 4062422 (-)
G153891 NA other downstream 401298 3248777 ~ 3286554 (-)
CI01000029_02589994_02592379 NA other downstream 1095050 2587549 ~ 2592379 (-)
CI01000029_01293143_01293964 BATF3 other downstream 2393729 1292249 ~ 1294123 (-)
CI01000029_04460778_04463540 FKBP1B other upstream 772215 4460159 ~ 4463540 (-)
G154415 NA other upstream 1297980 4986108 ~ 4990990 (-)
G156542 NA other upstream 3482239 7170367 ~ 7170951 (-)
G156495 NA other upstream 3678199 7365007 ~ 7371921 (-)

Expression


Co-expression Network