CI01000050_05327777_05328382 (PLP2)


Basic Information

Item Value
gene id CI01000050_05327777_05328382
gene name PLP2
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 5327777 ~ 5328399 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000050_05327777_05328382.mRNA
CTCATCAGTTTCATCATCCTCATCTGTTATGCCGCATCGATGTATGGAGGGTATACAGCTGTCGCCATCTGCGAGATGGTCTTTGCCATCATCTTCTTTGTTATCTTCATGATGGAGCTGGACAAACAGTTCCTGGTGGTGAACTGGCTCTGGAGCGATCTGTTCCGAGCTATAATCGGCGCAGCGCTTTATCTCATTACCTCTCTCATCTGTGTGATCGGTGGAGGTGGGGATGGGGCTCGCATCGCTGGTGGGGTGTTTGGTCTGCTGGCTGGGGTCTTGTTTGCTTATGATTCCTACACAATCTTCTTGGACATCAAGAGCAACAGACAGCATACAGCTGCTCCCACAGGTGCATGAACACATTCATTCATTCA

Function

symbol description
plp2 Enables chemokine binding activity. Predicted to be involved in ion transport. Located in plasma membrane.

GO:

id name namespace
GO:0016021 integral component of membrane cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000050_05327777_05328382.mRNA True 377 mRNA 0.50 3 5327777 5328399

Neighbor

gene id symbol gene type direction distance location
CI01000050_05300337_05306942 SYP, SYPB coding upstream 20835 5300337 ~ 5306942 (+)
CI01000050_05220463_05237857 OPN7D coding upstream 89430 5220463 ~ 5238347 (+)
CI01000050_05160439_05203170 NA coding upstream 124404 5159917 ~ 5203373 (+)
CI01000050_05069414_05117314 FRMD3 coding upstream 210463 5069414 ~ 5117314 (+)
CI01000050_05034897_05045722 GKAP1 coding upstream 281820 5034897 ~ 5045957 (+)
CI01000050_05362253_05376134 PRICKLE3 coding downstream 33854 5362253 ~ 5377514 (+)
CI01000050_05382547_05383818 NA coding downstream 53644 5382043 ~ 5383866 (+)
CI01000050_05388158_05405937 NA coding downstream 59663 5388062 ~ 5406041 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A coding downstream 79283 5407585 ~ 5409417 (+)
CI01000050_05529488_05530765 NA coding downstream 198763 5527162 ~ 5531422 (+)
G215478 NA non-coding upstream 14886 5279372 ~ 5312891 (+)
G215474 NA non-coding upstream 40415 5285639 ~ 5287362 (+)
G215348 NA non-coding upstream 199818 5122705 ~ 5127959 (+)
G215358 NA non-coding upstream 238198 5066806 ~ 5089579 (+)
G215380 NA non-coding upstream 403941 4923602 ~ 4923836 (+)
G215499 NA non-coding downstream 61550 5389949 ~ 5390319 (+)
G215500 NA non-coding downstream 75526 5403925 ~ 5404270 (+)
G215503 NA non-coding downstream 90761 5419160 ~ 5421264 (+)
G215511 NA non-coding downstream 126935 5455334 ~ 5455585 (+)
CI01000050_04591548_04592778 NA other upstream 734728 4589926 ~ 4593049 (+)
G214717 NA other upstream 1219497 4107582 ~ 4108280 (+)
CI01000050_03938328_03956122 RHOBTB2 other upstream 1370733 3931890 ~ 3957044 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other upstream 1519038 3805143 ~ 3808870 (+)
CI01000050_02852118_02864754 RNF122 other upstream 2461955 2852118 ~ 2865822 (+)
G215539 NA other downstream 301211 5629610 ~ 5631203 (+)
G215773 NA other downstream 1332789 6661188 ~ 6665703 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_036751 plp2 coding NC_007119.7 CM002892.2 49310785 ~ 49345388 (-)