G215910


Basic Information

Item Value
gene id G215910
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 4922751 ~ 4923220 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU244936
CGTACTACAATGGATGGTCTAAATGGATGGATTTCTGGATGGTTGGTGAGTGGCCACCACGTTCCAACAAGACTGTGACGTCAGCAGGGAGCTGGCGGGTGATGGTTTGGGCTGGAATATTGGGAAGTGAGATGGAAGGTCCCTGTAGGGTCTCTGAGGGTATTAAAATGACTTTTGCAAGATATGTGGAGTTCATAACTAGCCATTTTCAGCTATGGTATAAAAAGGAGGATAGTGCCTTCTGAAATACAATGCACTATGCACTATCCCATGCTGCAAAAAAAACACCACAGCAATAAAACTGTTTGAAAATGTATTTCTACACCCACTGTAAATGTTTCTCTTTGTGAGGTTTGGTTAGCAGCTTCAAATACCTGTTTGCTGCTCAACACTGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU244936 True 396 lncRNA 0.43 2 4922751 4923220

Neighbor

gene id symbol gene type direction distance location
CI01000050_04844985_04863467 NAA35 coding downstream 59284 4844985 ~ 4863467 (-)
CI01000050_04821454_04823915 NA coding downstream 98836 4821121 ~ 4823915 (-)
CI01000050_04786504_04807380 NA coding downstream 112399 4786316 ~ 4810352 (-)
CI01000050_04781467_04784451 NA coding downstream 138164 4781003 ~ 4784587 (-)
CI01000050_04732489_04733933 NA coding downstream 188818 4731986 ~ 4733933 (-)
CI01000050_04943326_05005151 NTRK2, NTRK2A coding upstream 20050 4943270 ~ 5005151 (-)
CI01000050_05008397_05010031 NA coding upstream 84521 5007741 ~ 5010040 (-)
CI01000050_05128945_05154128 RASEF coding upstream 204947 5128167 ~ 5154512 (-)
CI01000050_05206986_05209502 NA coding upstream 283314 5206534 ~ 5209502 (-)
CI01000050_05275592_05286286 NFU1 coding upstream 352348 5275568 ~ 5286617 (-)
G215904 NA non-coding downstream 10715 4911765 ~ 4912036 (-)
G215872 NA non-coding downstream 14600 4906541 ~ 4908151 (-)
G215880 NA non-coding downstream 42595 4879872 ~ 4880156 (-)
G215839 NA non-coding downstream 146580 4773378 ~ 4776171 (-)
G215832 NA non-coding downstream 173829 4748641 ~ 4748922 (-)
G215914 NA non-coding upstream 11377 4934597 ~ 5386292 (-)
G215883 NA non-coding upstream 88501 5011721 ~ 5015987 (-)
G215886 NA non-coding upstream 111685 5034905 ~ 5046046 (-)
G215950 NA non-coding upstream 167026 5090246 ~ 5121659 (-)
G215915 NA non-coding upstream 464750 5387970 ~ 5388245 (-)
CI01000050_04564233_04580815 KANSL3 other downstream 309859 4563687 ~ 4581278 (-)
G214436 NA other downstream 1333694 3525816 ~ 3589057 (-)
CI01000050_03491159_03514757 NA other downstream 1411960 3491088 ~ 3514757 (-)
G214314 NA other downstream 1498494 3413448 ~ 3424257 (-)
G214027 NA other downstream 2349849 2557166 ~ 2572902 (-)
G215935 NA other upstream 125696 5048916 ~ 5073109 (-)
G216093 NA other upstream 566337 5489557 ~ 5552103 (-)
G216408 NA other upstream 1432797 6356017 ~ 6356511 (-)
G216931 NA other upstream 2240875 7164095 ~ 7165401 (-)

Expression


Co-expression Network