G215722


Basic Information

Item Value
gene id G215722
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 6272147 ~ 6272384 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU244725
GAATTAGAGCGGAGACTGTGAGCCAGGGCTTCTTGTCCAACATCAGTGCCTGACCTCACAAATGCGCTTCTAGAAGAATGGTCAAAAATTCCCATAAACACACTCCCAAACCTTATGGAAAGCCTTCCCAGAAGAGCTGAAGCTGTTATGCTCCATATTAAACCCTATACGGATTAAGAATGGGATGTCATTAAATTGAATGTAAAGGCAGACATCCCAAAACTTTTGGCTATATATA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU244725 True 238 lncRNA 0.42 1 6272147 6272384

Neighbor

gene id symbol gene type direction distance location
CI01000050_06261124_06264271 NA coding upstream 7317 6261124 ~ 6264830 (+)
CI01000050_06086847_06251892 PRDM16 coding upstream 20255 6086847 ~ 6251892 (+)
CI01000050_05881217_05905972 MFN2 coding upstream 365866 5881217 ~ 5906281 (+)
CI01000050_05845707_05846552 NA coding upstream 425307 5845279 ~ 5846840 (+)
CI01000050_05819139_05823958 NA coding upstream 448189 5819074 ~ 5823958 (+)
CI01000050_06302230_06302696 NA coding downstream 29351 6301735 ~ 6302764 (+)
CI01000050_06307476_06308324 NA coding downstream 35092 6307476 ~ 6308696 (+)
CI01000050_06311242_06312395 NPPA coding downstream 38787 6311171 ~ 6313430 (+)
CI01000050_06343875_06352994 MTHFR coding downstream 70935 6343319 ~ 6354241 (+)
CI01000050_06413155_06428371 NA coding downstream 140128 6412512 ~ 6428983 (+)
G215667 NA non-coding upstream 99260 6171014 ~ 6172887 (+)
G215687 NA non-coding upstream 298601 5973320 ~ 5973546 (+)
G215679 NA non-coding upstream 329180 5942747 ~ 5942967 (+)
G215656 NA non-coding upstream 354227 5917606 ~ 5917920 (+)
G215728 NA non-coding downstream 6845 6279229 ~ 6279465 (+)
G215702 NA non-coding downstream 86189 6358573 ~ 6358830 (+)
G215774 NA non-coding downstream 433626 6706010 ~ 6707922 (+)
G216552 NA non-coding downstream 535383 6807767 ~ 6808079 (+)
G215539 NA other upstream 640944 5629610 ~ 5631203 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other upstream 862499 5407585 ~ 5409417 (+)
CI01000050_04591548_04592778 NA other upstream 1679098 4589926 ~ 4593049 (+)
G214717 NA other upstream 2163867 4107582 ~ 4108280 (+)
CI01000050_03938328_03956122 RHOBTB2 other upstream 2315103 3931890 ~ 3957044 (+)
G215773 NA other downstream 388804 6661188 ~ 6665703 (+)

Expression


Co-expression Network