RNA id: XM_043218675.1


Basic Information

Item Value
RNA id XM_043218675.1
length 361
RNA type mRNA
GC content 0.56
exon number 3
gene id rps29
representative False

Chromosome Information

Item Value
chromosome id NC_056718.1
NCBI id CM032087.1
chromosome length 27616869
location 26483321 ~ 26560387 (-)
genome version ASM1883169v1_2021_tiger_barb_Genome
species tiger barb
(Puntius tetrazona)

Sequence

GCAGGAAGCGCGCGGCTCCGCAGAAGCAGCGCGGCTTTTCTGCGCCTGCGCACGAGCGCCACTTCCTTTTCCACATCCCGATCGAGAGAGACGAGATGGGCCATCAGCAGCTCTACTGGAGTCACCCCCGAAAATACGGCCAGGGATCCCGATCCTGCCGGGTTTGCTCGAACAGACACGGTCTGATTCGTAAGTACGGACTCAACATGTGCCGCCAGTGCTTCAGGCAATACGCTAAAGATATCGGCTCCGTCAAGCTGGACTGAACTCATGACCGCCGGTCCTCCGTGGAGAGCCCACCATCCTGACGGCATGAAGTTACTCTGAAACGTTCAATAAACATTGCTTTTGTTTCTGTTGA

Function

GO:

id name namespace
GO:0072332 intrinsic apoptotic signaling pathway by p53 class mediator biological_process
GO:0051726 regulation of cell cycle biological_process
GO:0048821 erythrocyte development biological_process
GO:0006412 translation biological_process
GO:0001525 angiogenesis biological_process
GO:0060218 hematopoietic stem cell differentiation biological_process
GO:0001570 vasculogenesis biological_process
GO:0009790 embryo development biological_process
GO:0022627 cytosolic small ribosomal subunit cellular_component
GO:0008270 zinc ion binding molecular_function
GO:0003735 structural constituent of ribosome molecular_function

KEGG: NA

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TU210370 lncRNA downstream 3393 26547188 ~ 26555553 (-) True G142362
TU210364 lncRNA downstream 79161 26479302 ~ 26479785 (-) True G142356
TU210363 lncRNA downstream 79750 26478551 ~ 26479196 (-) True G142355
TU210362 lncRNA downstream 86186 26472357 ~ 26472760 (-) True G142354
TU210349 lncRNA downstream 177673 26364019 ~ 26381273 (-) False G142349
TU210399 lncRNA upstream 114042 26674429 ~ 26674883 (-) True G142381
TU210402 lncRNA upstream 155805 26716192 ~ 26716709 (-) True G142384
TU210428 lncRNA upstream 190196 26750583 ~ 26757783 (-) False LOC122325367
XR_006247290.1 lncRNA upstream 196666 26757053 ~ 26758203 (-) True LOC122325367
XR_006247289.1 lncRNA upstream 196666 26757053 ~ 26757924 (-) False LOC122325367
XM_043220471.1 mRNA downstream 119023 26325231 ~ 26439923 (-) False LOC122325425
XM_043220473.1 mRNA downstream 119024 26325231 ~ 26439922 (-) False LOC122325425
XM_043220470.1 mRNA downstream 119024 26325231 ~ 26439922 (-) True LOC122325425
XM_043220472.1 mRNA downstream 119025 26325231 ~ 26439921 (-) False LOC122325425
XM_043220345.1 mRNA downstream 251134 26307401 ~ 26307812 (-) True LOC122325330
XM_043220347.1 mRNA upstream 9380 26569767 ~ 26574013 (-) True LOC122325332
XM_043219305.1 mRNA upstream 365846 26926233 ~ 26940284 (-) True ganaba
XM_043220055.1 mRNA upstream 386943 26947330 ~ 26948895 (-) True her7
XM_043220045.1 mRNA upstream 586089 27146476 ~ 27148045 (-) True LOC122325133
XM_043220349.1 mRNA upstream 670272 27230659 ~ 27257482 (-) True LOC122325335
TU210168 other downstream 324701 26232024 ~ 26234245 (-) True G142278
TU210175 other downstream 371027 26185660 ~ 26187919 (-) True G142281
XR_006247174.1 other downstream 461975 26088415 ~ 26096971 (-) False pgfa
XR_006247173.1 other downstream 461975 26088415 ~ 26096971 (-) True pgfa
XR_006247181.1 other downstream 504768 26052206 ~ 26054178 (-) False LOC122324466
unassigned_transcript_2516 other upstream 54256 26614643 ~ 26614730 (-) True trnas-gcu_32
TU210476 other upstream 362428 26922815 ~ 26924987 (-) True G142444
TU210568 other upstream 669416 27229803 ~ 27256258 (-) False LOC122325335

Expression Profile