RNA id: TCONS_00012010


Basic Information

Item Value
RNA id TCONS_00012010
length 538
RNA type mRNA
GC content 0.41
exon number 2
gene id XLOC_006087
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 31285660 ~ 31289625 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GAAGTACAACACTGAACCTAACCGGCTCAAAGAGGGGAATACTGTAAGAAGCTTTAAAGCAAAACCTGGTGGTCCGCCCGTCCAACCATGCAACCATCCAGAGCATAGTCAAGGCTGTTGGGATCATTCCAGGTATCCCAGAGCCATGCTGTGTCCCAGAGAAGATGAAACCTCTCAGTGTATTATTTGTGGATGAGAGCAAAAACATTGTATTGAAGATCTACCCCAACATGTCTGTGGAGACATGCGCATGTAGATAGACTCGCTGGCAGAGGAAGGAAAAACAAATGGGCATTGTTTTGGTTTTGACACCCAAATTTACCTTGAAGAGGCATATTGTCTTTAGTTGCACTTGGTGGGAAGTGCACACGTTTGTATGGACTGCATTTCATCTCTTATTTTATACAGTATCTGTGATATTTCATTACTTCTGTTCTAAACCTTTTTAATTGTGCTAGATGAGTAACACGAGCACTTACTCTTACACTTATTTGCTTTTAAATTGTGAGATATGAATGGCTTAGATTACTGGATGTAC

Function

GO:

id name namespace
GO:0060395 SMAD protein signal transduction biological_process
GO:0010862 positive regulation of pathway-restricted SMAD protein phosphorylation biological_process
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005125 cytokine activity molecular_function
GO:0008083 growth factor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-090312-17 Predicted to enable cytokine activity. Predicted to be involved in SMAD protein signal transduction and positive regulation of pathway-restricted SMAD protein phosphorylation. Predicted to be located in extracellular region. Predicted to be active in extracellular space. Is expressed in several structures, including Bergmann glial cell; hypophysis; musculature system; otic vesicle; and sensory system. Orthologous to human GDF10 (growth differentiation factor 10).

Ensembl:

ensembl_id ENSDART00000142725

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00011994 lncRNA upstream 331038 30951267 ~ 30955038 (+) True XLOC_006075
TCONS_00013627 lncRNA upstream 357415 30920554 ~ 30928661 (+) True XLOC_006074
TCONS_00013626 lncRNA upstream 608433 30676825 ~ 30677643 (+) True XLOC_006067
TCONS_00011972 lncRNA upstream 1052396 30228101 ~ 30233680 (+) False XLOC_006062
TCONS_00012021 lncRNA downstream 242009 31531431 ~ 31532435 (+) True XLOC_006094
TCONS_00013628 lncRNA downstream 517098 31806520 ~ 31837960 (+) False XLOC_006101
TCONS_00013629 lncRNA downstream 517359 31806781 ~ 31815664 (+) False XLOC_006101
TCONS_00013631 lncRNA downstream 517359 31806781 ~ 31850508 (+) False XLOC_006101
TCONS_00013630 lncRNA downstream 517359 31806781 ~ 31850508 (+) False XLOC_006101
TCONS_00012008 mRNA upstream 57524 31211050 ~ 31228552 (+) True XLOC_006086
TCONS_00012007 mRNA upstream 59716 31205439 ~ 31226360 (+) False XLOC_006086
TCONS_00012006 mRNA upstream 89485 31192503 ~ 31196591 (+) True XLOC_006085
TCONS_00012005 mRNA upstream 100293 31184796 ~ 31185783 (+) True XLOC_006084
TCONS_00012004 mRNA upstream 103532 31182103 ~ 31182544 (+) True XLOC_006083
TCONS_00012011 mRNA downstream 7594 31297016 ~ 31317032 (+) False XLOC_006088
TCONS_00012012 mRNA downstream 7677 31297099 ~ 31326455 (+) False XLOC_006088
TCONS_00012013 mRNA downstream 31875 31321297 ~ 31335750 (+) True XLOC_006088
TCONS_00012014 mRNA downstream 100891 31390313 ~ 31392869 (+) False XLOC_006089
TCONS_00012015 mRNA downstream 100950 31390372 ~ 31391746 (+) True XLOC_006089
TCONS_00011984 other upstream 449300 30836656 ~ 30836776 (+) True XLOC_006071
TCONS_00011978 other upstream 774353 30511607 ~ 30511723 (+) True XLOC_006065
TCONS_00011975 other upstream 1034219 30251741 ~ 30251857 (+) True XLOC_006063
TCONS_00011948 other upstream 1500055 29778337 ~ 29786021 (+) False XLOC_006055
TCONS_00011936 other upstream 1530649 29755293 ~ 29755427 (+) True XLOC_006054
TCONS_00012034 other downstream 480399 31769821 ~ 31777526 (+) True XLOC_006100
TCONS_00012037 other downstream 1102961 32392383 ~ 32392499 (+) True XLOC_006105
TCONS_00012044 other downstream 1557071 32846493 ~ 32846609 (+) True XLOC_006111
TCONS_00012045 other downstream 1695232 32984654 ~ 32984769 (+) True XLOC_006113
TCONS_00012076 other downstream 3136826 34426248 ~ 34426365 (+) True XLOC_006133

Expression Profile

//