RNA id: TCONS_00051759


Basic Information

Item Value
RNA id TCONS_00051759
length 694
RNA type mRNA
GC content 0.52
exon number 7
gene id XLOC_026571
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 34129505 ~ 34136778 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGAGGGGTCGCGTGAGGGTTGCTCAACAGAAACATGCTACGTAGGGTCTTACGATGTGGTGTTTCTACACTGAGAGTCAGTAGGTCAGTTCATCAGAGTTCTCCATGGAGCAGTCCACTCATACCTATAGTTGTGGAGCAGACGGGACGAGGAGAGCGTGCTTATGACATCTACTCAAGGCTGCTTCGAGAGAGAATCATCTGCGTTATGGGTCCTATCGATGACTCTGTAGCTTCTCTGGTCATTGCTCAACTGCTCTTTCTTCAATCAGAGAGCAACAATAAGCCGATTCACATGTACATCAACAGCCCTGGTGGTGTGGTCACGTCTGGACTTGCCATCTATGATACTATGCAGTACATCCTAAATCCCATCTCCACCTGGTGTGTGGGTCAGGCAGCCAGCATGGGCAGTCTGCTTCTGGCCGCAGGAACCGCCGGAATGAGGCATTCCCTGCCTAATGCCCGAATCATGGTGCACCAGCCTTCTGGAGGAGCGAGGGGCCAAGCGACAGATATTGCCATCCAGGCAGAGGAGATTCTCAAACTGAAAAGACAGATCAACAACATCTACAGCAAACACACAGGACAGCTTCTGGAGACTATAGGTCTCGGCACTAGATACCCAAAATGCGCTCAGGCTTTCAGCACCACGGAGAGCCGCCTTCAAGTCACCGCGTTTGTGGAGAATTCTC

Function

GO:

id name namespace
GO:0006508 proteolysis biological_process
GO:0006515 protein quality control for misfolded or incompletely synthesized proteins biological_process
GO:0009368 endopeptidase Clp complex cellular_component
GO:0004176 ATP-dependent peptidase activity molecular_function
GO:0004252 serine-type endopeptidase activity molecular_function
GO:0016787 hydrolase activity molecular_function
GO:0008233 peptidase activity molecular_function
GO:0008236 serine-type peptidase activity molecular_function
GO:0051117 ATPase binding molecular_function

KEGG:

id description
ko04112 Cell cycle - Caulobacter
ko04212 Longevity regulating pathway - worm
ko01002 Peptidases and inhibitors

ZFIN:

id description
ZDB-GENE-030131-7860 Predicted to enable ATP-dependent peptidase activity; ATPase binding activity; and serine-type endopeptidase activity. Predicted to be involved in protein quality control for misfolded or incompletely synthesized proteins. Predicted to act upstream of or within proteolysis. Predicted to be part of endopeptidase Clp complex. Human ortholog(s) of this gene implicated in Perrault syndrome. Orthologous to human CLPP (caseinolytic mitochondrial matrix peptidase proteolytic subunit).

Ensembl:

ensembl_id ENSDART00000136900

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051677 lncRNA downstream 193051 33936453 ~ 33938821 (-) True XLOC_026512
TCONS_00051675 lncRNA downstream 196434 33922620 ~ 33935438 (-) False XLOC_026512
TCONS_00053065 lncRNA downstream 212677 33918566 ~ 33919195 (-) True XLOC_026511
TCONS_00051667 lncRNA downstream 441118 33681518 ~ 33690754 (-) True XLOC_026509
TCONS_00051659 lncRNA downstream 694140 33435754 ~ 33437732 (-) True XLOC_026506
TCONS_00053066 lncRNA upstream 3269 34139637 ~ 34141181 (-) True XLOC_026572
TCONS_00051762 lncRNA upstream 43439 34179807 ~ 34180432 (-) False XLOC_026573
TCONS_00051763 lncRNA upstream 43439 34179807 ~ 34180451 (-) True XLOC_026573
TCONS_00051771 lncRNA upstream 333786 34470154 ~ 34477363 (-) False XLOC_026575
TCONS_00051773 lncRNA upstream 389574 34525942 ~ 34546406 (-) False XLOC_026575
TCONS_00051756 mRNA downstream 15986 34115438 ~ 34115886 (-) True XLOC_026570
TCONS_00051755 mRNA downstream 18034 34113410 ~ 34113838 (-) True XLOC_026569
TCONS_00051754 mRNA downstream 24187 34107197 ~ 34107685 (-) True XLOC_026568
TCONS_00051753 mRNA downstream 25401 34106046 ~ 34106471 (-) True XLOC_026567
TCONS_00051751 mRNA downstream 29797 34101631 ~ 34102075 (-) True XLOC_026566
TCONS_00051760 mRNA upstream 37636 34174004 ~ 34180464 (-) False XLOC_026573
TCONS_00051761 mRNA upstream 40679 34177047 ~ 34180364 (-) False XLOC_026573
TCONS_00051764 mRNA upstream 122387 34258755 ~ 34337969 (-) False XLOC_026574
TCONS_00051765 mRNA upstream 128681 34265049 ~ 34279109 (-) False XLOC_026574
TCONS_00051767 mRNA upstream 128681 34265049 ~ 34296361 (-) False XLOC_026574
TCONS_00051752 other downstream 28507 34102957 ~ 34103365 (-) True XLOC_026563
TCONS_00051740 other downstream 45389 34086041 ~ 34086483 (-) True XLOC_026558
TCONS_00051725 other downstream 66936 34063955 ~ 34064936 (-) True XLOC_026547
TCONS_00051722 other downstream 73155 34058679 ~ 34058717 (-) True XLOC_026544
TCONS_00051716 other downstream 83219 34048205 ~ 34048653 (-) True XLOC_026539
TCONS_00051772 other upstream 389574 34525942 ~ 34546399 (-) False XLOC_026575
TCONS_00051781 other upstream 515942 34652310 ~ 34656737 (-) False XLOC_026581
TCONS_00051782 other upstream 516604 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051787 other upstream 607211 34743579 ~ 34753541 (-) True XLOC_026582
TCONS_00051789 other upstream 631173 34767541 ~ 34775954 (-) False XLOC_026583

Expression Profile

//