RNA id: TCONS_00000540



Basic Information


Item Value
RNA id TCONS_00000540
length 508
lncRNA type retained_intron
GC content 0.46
exon number 3
gene id XLOC_000324
representative True

Chromosome Information


Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 26605065 ~ 26654311 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ACAATAGGGATCATTTTCTAGTCAGAACATGTCTTTGAATGTCTTCCAGGTGTCATGCCAAAGAGAGGACTTGATGTGTGTTCCTGTGAAATCTTCAGATTCTACAAGCTAGTGACAATCAAAAGTCTCATAGAACCTCTCTCCATGATCGTTCCACGAAGGTCAGAGTCCTATCAAGAGGACATTTACCCCATGACAGCTGGAAACAAGCCCGCCATGACAGCAAATGAGTGGATCAGTGGTCTAGACAAAGGTCCTGTGATGATGTCACTGAGGCCTGGAAGTAAAGTGGACACATATGTGGAGTTGGGTTTGAAGAAAAGCCCAATGGAATCAACAGAGATGCACAATTCTCGCAGTCAGCCTGGGTTGTCACAGCTCATTCAGCGACTAGAGACCAAAGATGGAAACGGACGCAAAGAATCCCACCCTACATTATTACTCCCATCCACTGAAGAAAACGGCAGTTCTGCAAGCCATGTCAGCAATGGACAGCTAGATTCCCCAC

Function


GO:

id name namespace
GO:0017053 transcription repressor complex cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0051015 actin filament binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-2258 Predicted to enable actin filament binding activity. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be part of transcription repressor complex. Is expressed in several structures, including apical ectodermal ridge pectoral fin bud; ectoderm; endoderm; neural plate; and presumptive ectoderm. Orthologous to human CORO2A (coronin 2A).

Ensembl:

ensembl_id ENSDART00000152306

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00000536 lncRNA upstream 21340 26605214 ~ 26627687 (+) False XLOC_000324
TCONS_00000534 lncRNA upstream 64434 26577288 ~ 26584593 (+) False XLOC_000323
TCONS_00002841 lncRNA upstream 65567 26580088 ~ 26583460 (+) False XLOC_000323
TCONS_00002840 lncRNA upstream 65960 26577487 ~ 26583067 (+) False XLOC_000323
TCONS_00003076 lncRNA upstream 65960 26580184 ~ 26583067 (+) True XLOC_000323
TCONS_00003077 lncRNA downstream 13462 26664689 ~ 26670103 (+) False XLOC_000325
TCONS_00000545 lncRNA downstream 16799 26668026 ~ 26669885 (+) True XLOC_000325
TCONS_00003078 lncRNA downstream 88888 26740115 ~ 26741149 (+) True XLOC_000327
TCONS_00003079 lncRNA downstream 1062152 27713379 ~ 27716251 (+) False XLOC_000329
TCONS_00000566 lncRNA downstream 1326162 27977389 ~ 27995053 (+) False XLOC_000332
TCONS_00000538 mRNA upstream 8129 26622249 ~ 26640898 (+) False XLOC_000324
TCONS_00000529 mRNA upstream 139711 26467232 ~ 26509316 (+) False XLOC_000321
TCONS_00000528 mRNA upstream 139711 26467232 ~ 26509316 (+) False XLOC_000321
TCONS_00000526 mRNA upstream 140883 26467071 ~ 26508144 (+) False XLOC_000321
TCONS_00000531 mRNA upstream 151021 26480890 ~ 26498006 (+) False XLOC_000321
TCONS_00000541 mRNA downstream 16645 26667872 ~ 26671210 (+) False XLOC_000325
TCONS_00000542 mRNA downstream 16662 26667889 ~ 26669774 (+) False XLOC_000325
TCONS_00000543 mRNA downstream 16748 26667975 ~ 26669819 (+) False XLOC_000325
TCONS_00000544 mRNA downstream 16773 26668000 ~ 26669900 (+) False XLOC_000325
TCONS_00000546 mRNA downstream 25531 26676758 ~ 26700439 (+) False XLOC_000326
TCONS_00000518 other upstream 529403 26111385 ~ 26119624 (+) True XLOC_000317
TCONS_00000495 other upstream 1528822 25120089 ~ 25120205 (+) True XLOC_000301
TCONS_00000490 other upstream 2264330 24382967 ~ 24384697 (+) True XLOC_000295
TCONS_00000480 other upstream 2534469 24114525 ~ 24114558 (+) True XLOC_000287
TCONS_00000478 other upstream 2782062 23866878 ~ 23866965 (+) True XLOC_000285
TCONS_00000557 other downstream 1062122 27713349 ~ 27730980 (+) False XLOC_000329
TCONS_00000565 other downstream 1326143 27977370 ~ 28001937 (+) False XLOC_000332
TCONS_00000567 other downstream 1333166 27984393 ~ 27995611 (+) True XLOC_000332
TCONS_00000579 other downstream 2417435 29068662 ~ 29080336 (+) False XLOC_000337
TCONS_00000608 other downstream 3180532 29831759 ~ 29860373 (+) False XLOC_000356

Expression Profile


//