RNA id: TCONS_00007020



Basic Information


Item Value
RNA id TCONS_00007020
length 487
RNA type nonsense_mediated_decay
GC content 0.47
exon number 4
gene id XLOC_003598
representative True

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 36355348 ~ 36376073 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


ACAAGTTGGTCGATATAAGTCCTCCGTTTTCCCGCTATCGAAAACCTTGAATGTCATTCTCTCGTGTCCTTTTCTTCTATTAAAAACCAAAATAGGAAACTAAACCGGAATCGAAGTGTTTTGTATCAGCGACAGCGTAAAACCACCCAAACATGGAAGTCGTGCAGAAAGTCATGTCGGGATTTAGTCTGGATTTGGGACCTGTGAAAGAGCCACTGGGATTTATCCGACTCCTGGAATGGGCTTCCGAGTCACCCATACCTGATTAATCATTGCAATGGCTCCAAGAACACGACTTACCTGCAGGGAGATTTCTCATCCTCAGCTGAATTCTTCGTCTCTATTGGCGTCTTGGGTTTTCTGTACTGTACCTTCACCCTTATCCTGTACTTGGGCTACCAGCAGGTTTACAGGGAGTCGAACCGAGGCCCCATCATCGATCTGGTGGTGACCGGGATCTTTGCCTTCTTGTGGCTGGTTTGCTCCT

Function


GO:

id name namespace
GO:0030672 synaptic vesicle membrane cellular_component
GO:0008021 synaptic vesicle cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0017075 syntaxin-1 binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-1434 Predicted to be located in membrane and synaptic vesicle. Predicted to be integral component of membrane. Predicted to be active in synaptic vesicle membrane. Is expressed in pronephric duct. Orthologous to human SYPL2 (synaptophysin like 2).

Ensembl:

ensembl_id ENSDART00000161026

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00007013 lncRNA upstream 208516 36052731 ~ 36146847 (+) True XLOC_003594
TCONS_00008412 lncRNA upstream 1040129 35298843 ~ 35315234 (+) False XLOC_003592
TCONS_00008411 lncRNA upstream 1040129 35298843 ~ 35315234 (+) True XLOC_003592
TCONS_00007009 lncRNA upstream 1160825 35189723 ~ 35194538 (+) False XLOC_003590
TCONS_00008650 lncRNA upstream 1160825 35189864 ~ 35194538 (+) True XLOC_003590
TCONS_00007026 lncRNA downstream 124902 36494094 ~ 36500806 (+) True XLOC_003602
TCONS_00007028 lncRNA downstream 136482 36505674 ~ 36515323 (+) False XLOC_003603
TCONS_00007027 lncRNA downstream 136482 36505674 ~ 36515323 (+) True XLOC_003603
TCONS_00007029 lncRNA downstream 150779 36519971 ~ 36528422 (+) True XLOC_003604
TCONS_00007030 lncRNA downstream 172359 36541551 ~ 36547269 (+) True XLOC_003605
TCONS_00007018 mRNA upstream 105461 36243774 ~ 36249902 (+) True XLOC_003597
TCONS_00007017 mRNA upstream 117687 36231248 ~ 36237676 (+) True XLOC_003596
TCONS_00007015 mRNA upstream 138712 36158276 ~ 36216651 (+) False XLOC_003595
TCONS_00007016 mRNA upstream 140578 36180349 ~ 36214785 (+) True XLOC_003595
TCONS_00007014 mRNA upstream 140708 36158134 ~ 36214655 (+) False XLOC_003595
TCONS_00007021 mRNA downstream 10101 36379293 ~ 36407866 (+) False XLOC_003599
TCONS_00007023 mRNA downstream 39444 36408636 ~ 36415264 (+) False XLOC_003600
TCONS_00007024 mRNA downstream 40265 36409457 ~ 36415700 (+) True XLOC_003600
TCONS_00007025 mRNA downstream 108289 36477481 ~ 36489816 (+) True XLOC_003601
TCONS_00007042 mRNA downstream 296167 36665359 ~ 36674376 (+) True XLOC_003615
TCONS_00007007 other upstream 1261641 35093605 ~ 35093722 (+) True XLOC_003588
TCONS_00007005 other upstream 1299831 35048642 ~ 35055532 (+) False XLOC_003587
TCONS_00006996 other upstream 2118272 34235356 ~ 34237091 (+) False XLOC_003580
TCONS_00006995 other upstream 2528252 33818189 ~ 33827111 (+) True XLOC_003578
TCONS_00006992 other upstream 2926371 33428874 ~ 33428992 (+) True XLOC_003576
TCONS_00007022 other downstream 10156 36379348 ~ 36385824 (+) True XLOC_003599
TCONS_00007036 other downstream 213066 36582258 ~ 36582372 (+) True XLOC_003609
TCONS_00007048 other downstream 625502 36994694 ~ 36994808 (+) True XLOC_003620
TCONS_00007061 other downstream 844916 37214108 ~ 37214223 (+) True XLOC_003626
TCONS_00007069 other downstream 995254 37364446 ~ 37364560 (+) True XLOC_003628

Expression Profile


//