RNA id: TCONS_00074962


Basic Information

Item Value
RNA id TCONS_00074962
length 795
lncRNA type intronic
GC content 0.37
exon number 3
gene id XLOC_037663
representative True

Chromosome Information

Item Value
chromosome id NC_007120.7
NCBI id CM002893.2
chromosome length 56459846
location 10368380 ~ 10370625 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ggcgtgactcctttttcattgcccgggatttagcaggcagacgcagcttctgcaatggtcgacattaactgctcccagcagcggatctgattaacacgataccaaagtgattttgttacctgtggatcttcaaacttcacatccagagttgtgaggaatcagaggtgcatgcggctgcccacgggaaaaaattgccatcagcccaacacagtttggattatcataggactgtcagaggtttgccaaacctgtcaaatgcatgatggctcctgtttggacttaccgatgtcctcgacttcaagtatccatcaaaactgtatacatttaagatgtattagagactctttgtgggactggacattatgcatccaaaatcttcatcaaaatatgcaaatctcctcactgagttgccttggatgatttctcaataggatctggtattattaatgtttttatttatgtattgtgtacgtgtagccacattaatggcctattttgtagtcactattaaaaggaacattgattgatattgaatacatgttatggtctttaatccatcttcccattcttatttaattgttattgacaggaaagtctgtttatctgtgtttactagtgtatattgtgcttacaatatagaaacgccgatttattttctgaggttacagccagaagtcaattaaattcgttttaaatgacatatgcatggttaattttatttagatcattaagttcataatacttaattaaaatgagtacagtcaacatatagcaatgtataagtaagttaagttt

Function

GO:

id name namespace
GO:0019219 regulation of nucleobase-containing compound metabolic process biological_process
GO:0019222 regulation of metabolic process biological_process
GO:0016070 RNA metabolic process biological_process
GO:0048762 mesenchymal cell differentiation biological_process
GO:0080090 regulation of primary metabolic process biological_process
GO:0018130 heterocycle biosynthetic process biological_process
GO:0006351 transcription, DNA-templated biological_process
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0006357 regulation of transcription by RNA polymerase II biological_process
GO:0051171 regulation of nitrogen compound metabolic process biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0009889 regulation of biosynthetic process biological_process
GO:0097659 nucleic acid-templated transcription biological_process
GO:0031323 regulation of cellular metabolic process biological_process
GO:0031326 regulation of cellular biosynthetic process biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0051252 regulation of RNA metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:1903506 regulation of nucleic acid-templated transcription biological_process
GO:0048863 stem cell differentiation biological_process
GO:1901362 organic cyclic compound biosynthetic process biological_process
GO:0010467 gene expression biological_process
GO:0010468 regulation of gene expression biological_process
GO:0044260 cellular macromolecule metabolic process biological_process
GO:0060485 mesenchyme development biological_process
GO:0014033 neural crest cell differentiation biological_process
GO:0060255 regulation of macromolecule metabolic process biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:2001141 regulation of RNA biosynthetic process biological_process
GO:0032774 RNA biosynthetic process biological_process
GO:0019438 aromatic compound biosynthetic process biological_process
GO:0010556 regulation of macromolecule biosynthetic process biological_process
GO:0034654 nucleobase-containing compound biosynthetic process biological_process
GO:2000112 regulation of cellular macromolecule biosynthetic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0005634 nucleus cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043565 sequence-specific DNA binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003677 DNA binding molecular_function
GO:0003690 double-stranded DNA binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000976 transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000977 RNA polymerase II transcription regulatory region sequence-specific DNA binding molecular_function
GO:0000981 DNA-binding transcription factor activity, RNA polymerase II-specific molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0140110 transcription regulator activity molecular_function
GO:0001067 regulatory region nucleic acid binding molecular_function
GO:1990837 sequence-specific double-stranded DNA binding molecular_function

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00073926 lncRNA downstream 997514 9355372 ~ 9370866 (-) True XLOC_037651
TCONS_00073922 lncRNA downstream 1079310 9286419 ~ 9289070 (-) True XLOC_037649
TCONS_00073923 lncRNA downstream 1079320 9286419 ~ 9289060 (-) False XLOC_037649
TCONS_00073924 lncRNA downstream 1079341 9286419 ~ 9289039 (-) False XLOC_037649
TCONS_00075297 lncRNA downstream 1317865 9026383 ~ 9050515 (-) True XLOC_037645
TCONS_00073971 lncRNA upstream 1184451 11555076 ~ 11560109 (-) False XLOC_037670
TCONS_00073972 lncRNA upstream 1186581 11557206 ~ 11560339 (-) True XLOC_037670
TCONS_00075298 lncRNA upstream 1200687 11571312 ~ 11572249 (-) False XLOC_037671
TCONS_00075299 lncRNA upstream 1200687 11571312 ~ 11572354 (-) False XLOC_037671
TCONS_00075300 lncRNA upstream 1225362 11595987 ~ 11598944 (-) False XLOC_037673
TCONS_00073955 mRNA downstream 10742 10157382 ~ 10357638 (-) True XLOC_037662
TCONS_00073952 mRNA downstream 222500 10138200 ~ 10145880 (-) True XLOC_037661
TCONS_00073951 mRNA downstream 222585 10138196 ~ 10145795 (-) False XLOC_037661
TCONS_00073950 mRNA downstream 300275 10051954 ~ 10068105 (-) True XLOC_037660
TCONS_00073949 mRNA downstream 300376 10050890 ~ 10068004 (-) False XLOC_037660
TCONS_00073956 mRNA upstream 387714 10758339 ~ 10769097 (-) True XLOC_037664
TCONS_00073957 mRNA upstream 407602 10778227 ~ 10778615 (-) True XLOC_037665
TCONS_00073959 mRNA upstream 411062 10781687 ~ 10805231 (-) False XLOC_037666
TCONS_00073958 mRNA upstream 411062 10781687 ~ 10805231 (-) False XLOC_037666
TCONS_00073960 mRNA upstream 416654 10787279 ~ 10804796 (-) True XLOC_037666
TCONS_00073935 other downstream 563061 9743559 ~ 9805319 (-) False XLOC_037657
TCONS_00073936 other downstream 563061 9770335 ~ 9805319 (-) True XLOC_037657
TCONS_00073901 other downstream 2713079 7641760 ~ 7655301 (-) True XLOC_037633
TCONS_00073897 other downstream 2829357 7522435 ~ 7539023 (-) True XLOC_037632
TCONS_00073875 other downstream 3650579 6717677 ~ 6717801 (-) True XLOC_037618
TCONS_00073961 other upstream 475293 10845918 ~ 10846549 (-) True XLOC_037667
TCONS_00073965 other upstream 1178147 11548772 ~ 11550397 (-) False XLOC_037669
TCONS_00073967 other upstream 1180979 11551604 ~ 11551704 (-) True XLOC_037669
TCONS_00073973 other upstream 1201348 11571973 ~ 11572055 (-) True XLOC_037671
TCONS_00073978 other upstream 1451754 11822379 ~ 11855305 (-) True XLOC_037675

Expression Profile

//