RNA id: TCONS_00007761


Basic Information

Item Value
RNA id TCONS_00007761
length 416
RNA type mRNA
GC content 0.50
exon number 5
gene id XLOC_004066
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 16329776 ~ 16395956 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GTGTGTATTATCTATCAGACCAGGAAGAAGAGCGAGGAGTGCAGTGTAAACACAGATGAGACGATTGTCCCTCCTGATGTTCCCAGTTACCTGTCCTCTCAGGGCACTTTATCAGAAAGACAGGACGTGTGTATACGAGTGGAGTCCAATGGGGGATCTCAGCCCAATGGACGAATAGAAAGCAATGGCTACGATGTGCCGGTCGTGTGCGCAGACTGCTTGGAAAACAGCACCAGCTACTCCAAACACTGTAACTACCTCCCTCACGATTTAGCGCCCCCTTCAGGCATGGAGTATCAGCAGACGCACCAAACACCCATCTTTCCCACCAACCACGACAGGGTGACAATATCACCCTCATCAAACCAGTACAGTGACCGAAATGGATTGTTGGTGAACAAGTCAGACACACCACT

Function

GO:

id name namespace
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-031113-23 Predicted to be located in membrane. Predicted to be integral component of membrane. Is expressed in axis; central nervous system; notochord; pharyngeal arch 3-7 skeleton; and somite. Orthologous to human LRIG1 (leucine rich repeats and immunoglobulin like domains 1).

Ensembl:

ensembl_id ENSDART00000165121

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00007756 lncRNA downstream 151474 16179952 ~ 16181688 (-) True XLOC_004065
TCONS_00008461 lncRNA downstream 212872 16120012 ~ 16120290 (-) True XLOC_004062
TCONS_00007750 lncRNA downstream 217372 16104008 ~ 16115790 (-) True XLOC_004061
TCONS_00007739 lncRNA downstream 486649 15845588 ~ 15846513 (-) True XLOC_004057
TCONS_00007734 lncRNA downstream 524143 15806643 ~ 15809019 (-) True XLOC_004055
TCONS_00007762 lncRNA upstream 36891 16373672 ~ 16395302 (-) True XLOC_004066
TCONS_00007764 lncRNA upstream 332437 16669218 ~ 16675164 (-) True XLOC_004068
TCONS_00008783 lncRNA upstream 744641 17081422 ~ 17091195 (-) True XLOC_004070
TCONS_00007766 lncRNA upstream 756972 17093753 ~ 17097933 (-) False XLOC_004071
TCONS_00007767 lncRNA upstream 757212 17093993 ~ 17095206 (-) False XLOC_004071
TCONS_00007754 mRNA downstream 117692 16176603 ~ 16215470 (-) False XLOC_004065
TCONS_00007755 mRNA downstream 118019 16179089 ~ 16215143 (-) False XLOC_004065
TCONS_00007753 mRNA downstream 180762 16143325 ~ 16152400 (-) True XLOC_004064
TCONS_00007752 mRNA downstream 181057 16139897 ~ 16152105 (-) False XLOC_004064
TCONS_00007748 mRNA downstream 217358 16094661 ~ 16115804 (-) False XLOC_004061
TCONS_00007765 mRNA upstream 401398 16738179 ~ 16975190 (-) True XLOC_004069
TCONS_00007771 mRNA upstream 1260198 17596979 ~ 17713987 (-) True XLOC_004074
TCONS_00007772 mRNA upstream 1389868 17726649 ~ 17755444 (-) True XLOC_004075
TCONS_00007773 mRNA upstream 1420561 17757342 ~ 17782930 (-) True XLOC_004076
TCONS_00007774 mRNA upstream 1448401 17785182 ~ 17803071 (-) False XLOC_004077
TCONS_00007751 other downstream 205484 16127382 ~ 16127678 (-) True XLOC_004063
TCONS_00007745 other downstream 274855 16058191 ~ 16058307 (-) True XLOC_004059
TCONS_00007744 other downstream 311691 16020929 ~ 16021471 (-) True XLOC_004058
TCONS_00007741 other downstream 313547 16017883 ~ 16019615 (-) False XLOC_004058
TCONS_00007689 other downstream 2850375 13482671 ~ 13482787 (-) True XLOC_004029
TCONS_00007763 other upstream 307616 16644397 ~ 16644513 (-) True XLOC_004067
TCONS_00007777 other upstream 1570121 17906902 ~ 17908682 (-) True XLOC_004078
TCONS_00007803 other upstream 2255218 18591999 ~ 18604435 (-) True XLOC_004089
TCONS_00007814 other upstream 2843671 19180452 ~ 19180555 (-) True XLOC_004095
TCONS_00007815 other upstream 3079397 19416178 ~ 19416315 (-) True XLOC_004096

Expression Profile

//