G212742


Basic Information

Item Value
gene id G212742
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 2250259 ~ 2250465 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU241289
AATGCAGACCTTATATATAATTACACCCACAAAAAATATGTACAAAACAAATTAAAAGATTAATCACAATAAAGTCTGTTACATTTTGTAAACAGGGTGTTTTAATCAAACAAACAGCACTTCAGCTCAATTCGAATGATGCGCCCATGGTGGAATAGTACGAAGCTCCTTTCAGAGTCTGTTCCCGCCCCTGATTGTAAAGTGTGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU241289 True 207 lncRNA 0.36 1 2250259 2250465

Neighbor

gene id symbol gene type direction distance location
CI01000050_02211327_02213220 NA coding upstream 36770 2210794 ~ 2213489 (+)
CI01000050_01877310_01902523 ADGRD2 coding upstream 347486 1877310 ~ 1902773 (+)
CI01000050_01803081_01804190 B3GALT4 coding upstream 443301 1800608 ~ 1806958 (+)
CI01000050_01701779_01712905 RBSN coding upstream 537181 1701614 ~ 1713078 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 coding upstream 551524 1691374 ~ 1698973 (+)
CI01000050_02268620_02283626 NADK, NADKA coding downstream 18155 2268620 ~ 2285331 (+)
CI01000050_02290349_02305843 WDR46 coding downstream 38462 2288927 ~ 2306023 (+)
CI01000050_02308087_02311804 NA coding downstream 56774 2307239 ~ 2311898 (+)
CI01000050_02328316_02331115 TUBB4A.S, MGC53997, TUBB4B, TUBB4A, TUBB4B.L, TBB2C, TUBB2B coding downstream 77761 2328226 ~ 2331515 (+)
CI01000050_02455292_02474612 NA coding downstream 202035 2452500 ~ 2474612 (+)
G212741 NA non-coding upstream 2971 2246954 ~ 2247288 (+)
G212626 NA non-coding upstream 17374 2232399 ~ 2232885 (+)
G212724 NA non-coding upstream 39717 2210265 ~ 2210542 (+)
G212710 NA non-coding upstream 41973 2207897 ~ 2208286 (+)
G212714 NA non-coding upstream 46393 2203642 ~ 2203866 (+)
G212751 NA non-coding downstream 70820 2321285 ~ 2321544 (+)
G212754 NA non-coding downstream 77186 2327651 ~ 2327886 (+)
G212755 NA non-coding downstream 87724 2338189 ~ 2338462 (+)
G212757 NA non-coding downstream 89632 2340097 ~ 2340405 (+)
CI01000050_01296683_01297763 SELENOK other upstream 950653 1296365 ~ 1298255 (+)
G212184 NA other upstream 1816053 433684 ~ 434206 (+)
G212006 NA other upstream 2112248 82604 ~ 138011 (+)
CI01000050_00012155_00026251 NA other upstream 2223847 12079 ~ 26412 (+)
G212927 NA other downstream 524374 2774839 ~ 2775133 (+)
CI01000050_02852118_02864754 RNF122 other downstream 592354 2852118 ~ 2865822 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other downstream 1554678 3805143 ~ 3808870 (+)
CI01000050_03938328_03956122 RHOBTB2 other downstream 1700137 3931890 ~ 3957044 (+)
G214717 NA other downstream 1857117 4107582 ~ 4108280 (+)

Expression


Co-expression Network