G215527


Basic Information

Item Value
gene id G215527
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 5558329 ~ 5558638 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU244500
TTTGGATGATATTATGCACTGTATATGATGATAACTTCAAACTCTTTGCAATTTTTCCCTGAGAAACTCCTTTCTGATATTGCTCCACTATTTTTCGCCGCAGCATTGGGGGAATTGGTGATCCTCTGCCCATCTTGACTTCTGAGAGACACTGCCACTCTGAGAGGCTCTTTTTATACCCAATCATGTTGCCAATTGACCTAATAAGTTGCAAATTGGTCCTCCAGCTGTTCCTTATATGTACATTTAACTTTTCCGGCCTCTTATTGCTACCTGTCCCAACTTTTTTGGAATGTGTAGCTCTCATGAA

Function

NR:

description
PREDICTED: regulator of microtubule dynamics protein 2-like isoform X1

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU244500 True 310 lncRNA 0.41 1 5558329 5558638

Neighbor

gene id symbol gene type direction distance location
CI01000050_05545206_05550365 NA coding upstream 7779 5543514 ~ 5550550 (+)
CI01000050_05529488_05530765 NA coding upstream 26907 5527162 ~ 5531422 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A coding upstream 148912 5407585 ~ 5409417 (+)
CI01000050_05388158_05405937 NA coding upstream 152288 5388062 ~ 5406041 (+)
CI01000050_05382547_05383818 NA coding upstream 174463 5382043 ~ 5383866 (+)
CI01000050_05774182_05793383 WRAP73 coding downstream 215544 5774182 ~ 5793898 (+)
CI01000050_05819139_05823958 NA coding downstream 260436 5819074 ~ 5823958 (+)
CI01000050_05845707_05846552 NA coding downstream 286641 5845279 ~ 5846840 (+)
CI01000050_05881217_05905972 MFN2 coding downstream 322579 5881217 ~ 5906281 (+)
CI01000050_06086847_06251892 PRDM16 coding downstream 528209 6086847 ~ 6251892 (+)
G215511 NA non-coding upstream 102744 5455334 ~ 5455585 (+)
G215503 NA non-coding upstream 137065 5419160 ~ 5421264 (+)
G215500 NA non-coding upstream 154059 5403925 ~ 5404270 (+)
G215499 NA non-coding upstream 168010 5389949 ~ 5390319 (+)
G215533 NA non-coding downstream 38290 5596928 ~ 5605133 (+)
G215551 NA non-coding downstream 52960 5611598 ~ 5612047 (+)
G215556 NA non-coding downstream 61843 5620481 ~ 5620689 (+)
G215541 NA non-coding downstream 62863 5621501 ~ 5629365 (+)
G215544 NA non-coding downstream 75512 5634150 ~ 5637539 (+)
CI01000050_04591548_04592778 NA other upstream 965280 4589926 ~ 4593049 (+)
G214717 NA other upstream 1450049 4107582 ~ 4108280 (+)
CI01000050_03938328_03956122 RHOBTB2 other upstream 1601285 3931890 ~ 3957044 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other upstream 1749590 3805143 ~ 3808870 (+)
G215539 NA other downstream 70972 5629610 ~ 5631203 (+)
G215773 NA other downstream 1102550 6661188 ~ 6665703 (+)

Expression


Co-expression Network