G215541


Basic Information

Item Value
gene id G215541
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 5621501 ~ 5629365 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU244524
AAAAAAGTGCATCCATCATAAACGTAATAATTAATAAAGGCCTTCTGAAGCAAAGCGATGCGTTTGTGTAAGAAAAATATCCATATTTAACAATTTAACAAGTAAAATATCTAGCTTCCGCCAGACTGCCTTGCGTATACAAGTTACGAAGAAAGTGTAAACTGGTGTCCCGTCAATTACACTTTTTCCGTAAGTTTAATAGGGAAGGCGCAAGCTTTGTGAACTGCAAGGTTTACACTTTCTGCGTACGTTGAATACAGAAGCCGTCTGGCGGAAGCTCAATATTCGACTTCATAACTTTAAATATGGATATTTTTTTTACACAAACGCAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU244524 True 332 lncRNA 0.36 2 5621501 5629365

Neighbor

gene id symbol gene type direction distance location
CI01000050_05545206_05550365 NA coding upstream 70951 5543514 ~ 5550550 (+)
CI01000050_05529488_05530765 NA coding upstream 90079 5527162 ~ 5531422 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A coding upstream 212084 5407585 ~ 5409417 (+)
CI01000050_05388158_05405937 NA coding upstream 215460 5388062 ~ 5406041 (+)
CI01000050_05382547_05383818 NA coding upstream 237635 5382043 ~ 5383866 (+)
CI01000050_05774182_05793383 WRAP73 coding downstream 144817 5774182 ~ 5793898 (+)
CI01000050_05819139_05823958 NA coding downstream 189709 5819074 ~ 5823958 (+)
CI01000050_05845707_05846552 NA coding downstream 215914 5845279 ~ 5846840 (+)
CI01000050_05881217_05905972 MFN2 coding downstream 251852 5881217 ~ 5906281 (+)
CI01000050_06086847_06251892 PRDM16 coding downstream 457482 6086847 ~ 6251892 (+)
G215556 NA non-coding upstream 812 5620481 ~ 5620689 (+)
G215551 NA non-coding upstream 9454 5611598 ~ 5612047 (+)
G215533 NA non-coding upstream 16368 5596928 ~ 5605133 (+)
G215527 NA non-coding upstream 62863 5558329 ~ 5558638 (+)
G215544 NA non-coding downstream 4785 5634150 ~ 5637539 (+)
G215588 NA non-coding downstream 89599 5718964 ~ 5719453 (+)
G215536 NA non-coding downstream 166023 5795388 ~ 5798253 (+)
G215631 NA non-coding downstream 195854 5825219 ~ 5825659 (+)
G215645 NA non-coding downstream 207899 5837264 ~ 5837596 (+)
CI01000050_04591548_04592778 NA other upstream 1028452 4589926 ~ 4593049 (+)
G214717 NA other upstream 1513221 4107582 ~ 4108280 (+)
CI01000050_03938328_03956122 RHOBTB2 other upstream 1664457 3931890 ~ 3957044 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other upstream 1812762 3805143 ~ 3808870 (+)
G215539 NA other downstream 245 5629610 ~ 5631203 (+)
G215773 NA other downstream 1031823 6661188 ~ 6665703 (+)

Expression


Co-expression Network