RNA id: TCONS_00013137


Basic Information

Item Value
RNA id TCONS_00013137
length 494
RNA type mRNA
GC content 0.53
exon number 2
gene id XLOC_006830
representative True

Chromosome Information

Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 37543498 ~ 37545487 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TAGACGCACAGACCTCTTTGAGCACTCAGACTGACAGTGCTTCCTCCAGTCTGTCTGTGTCTCACGCTGGAAATCCAGAACTGCTGCTGGGTTTATCCTACAACGCCACCACAGGACGACTTTCTGTGGAGATCATTAAAGGCAGCCACTTCCGTAACTTTGCAGTCAACAGACCTCCAGATACATTTGGTAAGCTCACTCTGTTGAACTCAATGGGACAGGAGATTTCCCGCTGTAAGACGTCGATCCGTCGCAGCCAGCCCAATCCTGTCTTCAAGGAGACGTTCGTCTTCCAGGTGGCGCTTTTCCAACTGTCTGACGTCACGTTAATGGTCTCCATTTACAATCGGCGGAACATGAAGCGTAAGGAGATGATAGGCTGGGTGGCTCTGGGCCAGAACAGCAGCGGTGAAGAGGAGCTTCTTCACTGGCAGGACATGAAGGAGAGCGGAAACCAACAGGTCTGCCGCTGGCACACGCTGCTGGATGCTTAG

Function

GO:

id name namespace
GO:0006887 exocytosis biological_process

KEGG: NA

ZFIN:

id description
ZDB-GENE-090313-210 Predicted to act upstream of or within exocytosis. Orthologous to human SYT16 (synaptotagmin 16).

Ensembl:

ensembl_id ENSDART00000131269

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00013874 lncRNA downstream 7713 37528161 ~ 37535785 (-) True XLOC_006829
TCONS_00013135 lncRNA downstream 8074 37528161 ~ 37535424 (-) False XLOC_006829
TCONS_00013136 lncRNA downstream 8171 37528161 ~ 37535327 (-) False XLOC_006829
TCONS_00013499 lncRNA downstream 432962 37110212 ~ 37110536 (-) True XLOC_006817
TCONS_00013498 lncRNA downstream 531262 37009812 ~ 37012236 (-) True XLOC_006815
TCONS_00013142 lncRNA upstream 61570 37607057 ~ 37608372 (-) True XLOC_006832
TCONS_00013145 lncRNA upstream 64317 37609804 ~ 37613031 (-) False XLOC_006833
TCONS_00013144 lncRNA upstream 64317 37609804 ~ 37614979 (-) True XLOC_006833
TCONS_00013876 lncRNA upstream 87139 37632626 ~ 37636598 (-) False XLOC_006836
TCONS_00013875 lncRNA upstream 87139 37632626 ~ 37636598 (-) False XLOC_006836
TCONS_00013134 mRNA downstream 23681 37493729 ~ 37519817 (-) True XLOC_006828
TCONS_00013133 mRNA downstream 23724 37491804 ~ 37519774 (-) False XLOC_006828
TCONS_00013132 mRNA downstream 68509 37469093 ~ 37474989 (-) True XLOC_006827
TCONS_00013131 mRNA downstream 77956 37430202 ~ 37465542 (-) True XLOC_006826
TCONS_00013130 mRNA downstream 77974 37421333 ~ 37465524 (-) False XLOC_006826
TCONS_00013138 mRNA upstream 41004 37586491 ~ 37600600 (-) False XLOC_006831
TCONS_00013141 mRNA upstream 60409 37605896 ~ 37608441 (-) False XLOC_006832
TCONS_00013143 mRNA upstream 63971 37609458 ~ 37615029 (-) False XLOC_006833
TCONS_00013146 mRNA upstream 72031 37617518 ~ 37620091 (-) False XLOC_006834
TCONS_00013147 mRNA upstream 72033 37617520 ~ 37620194 (-) False XLOC_006834
TCONS_00013121 other downstream 364782 37178602 ~ 37178716 (-) True XLOC_006819
TCONS_00013107 other downstream 782182 36757555 ~ 36761316 (-) True XLOC_006809
TCONS_00013090 other downstream 1008426 36530420 ~ 36535072 (-) False XLOC_006800
TCONS_00013082 other downstream 1144123 36399260 ~ 36399375 (-) True XLOC_006797
TCONS_00013081 other downstream 1212599 36321431 ~ 36330899 (-) True XLOC_006796
TCONS_00013139 other upstream 49028 37594515 ~ 37600539 (-) False XLOC_006831
TCONS_00013140 other upstream 53224 37598711 ~ 37599245 (-) True XLOC_006831
TCONS_00013157 other upstream 105186 37650673 ~ 37656690 (-) False XLOC_006839
TCONS_00013167 other upstream 1307650 38853137 ~ 38853252 (-) True XLOC_006846
TCONS_00013170 other upstream 1697068 39242555 ~ 39242672 (-) True XLOC_006848

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000012_04514814_04539220.mRNA True 2449 mRNA 0.52 8 CI01000012 4514814 ~ 4539599 (+)