RNA id: TCONS_00002952


Basic Information

Item Value
RNA id TCONS_00002952
length 419
lncRNA type sense_over
GC content 0.50
exon number 1
gene id XLOC_001236
representative True

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 24870661 ~ 25144439 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATCCGTGGACAGGGAGTCGTACAGGAATCGGTTGGATAAAGGCGATCGCGCTTTAACGGAGCAGCATCGGAGTCGCGTGCCGCATCCCTTGCTTTCTCAGATCGGTCACATATTATTCTATGGGGGATCTGAGTTTTTGCAGAAGATAACGAAGAAATTTCAGCTCTCCCTGATGCAGGGCTCCGAAGGGTGCGAATGACGCTCAGACTTTATTTCGGCGGATGAAAATGTTTGGTTTGTGCTTGTAAAACTTCAGCTCGTTTTCAGAGGATCGTTTCATCTTGCGTTCGGGCAAGCCGGAGAGGAGAAGAGGGGAGACCGGTTTATCCTAACCGAATTCTGGATTGGATATCTGAGGAAACTAACCGTTCGTTTGCACATAGGAGCTTTCCCCCTTCGCCTTTCCACCAGTTTCCAGG

Function

GO:

id name namespace
GO:0045746 negative regulation of Notch signaling pathway biological_process
GO:0001525 angiogenesis biological_process
GO:0031641 regulation of myelination biological_process
GO:0031642 negative regulation of myelination biological_process
GO:0032006 regulation of TOR signaling biological_process

KEGG:

id description
ko04120 Ubiquitin mediated proteolysis
ko04131 Membrane trafficking
ko04121 Ubiquitin system

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00002951 lncRNA downstream 119461 24967346 ~ 25024503 (-) False XLOC_001236
TCONS_00002950 lncRNA downstream 537202 24604431 ~ 24606762 (-) True XLOC_001234
TCONS_00003416 lncRNA downstream 538158 24602559 ~ 24605806 (-) False XLOC_001234
TCONS_00002949 lncRNA downstream 540612 24602332 ~ 24603352 (-) False XLOC_001234
TCONS_00002948 lncRNA downstream 540612 24602332 ~ 24603352 (-) False XLOC_001234
TCONS_00002008 lncRNA upstream 334385 25478767 ~ 25486419 (-) True XLOC_001240
TCONS_00003417 lncRNA upstream 411343 25555725 ~ 25558287 (-) True XLOC_001242
TCONS_00002014 lncRNA upstream 528060 25672442 ~ 25676099 (-) False XLOC_001244
TCONS_00003418 lncRNA upstream 564930 25709312 ~ 25714494 (-) False XLOC_001245
TCONS_00002019 lncRNA upstream 718584 25862966 ~ 25863639 (-) True XLOC_001247
TCONS_00001998 mRNA downstream 225278 24870661 ~ 24918686 (-) False XLOC_001236
TCONS_00001995 mRNA downstream 585126 24520503 ~ 24558838 (-) False XLOC_001233
TCONS_00001993 mRNA downstream 681420 24394320 ~ 24462544 (-) False XLOC_001232
TCONS_00001992 mRNA downstream 685868 24394320 ~ 24458096 (-) False XLOC_001232
TCONS_00002000 mRNA upstream 9694 25154076 ~ 25177086 (-) False XLOC_001237
TCONS_00002001 mRNA upstream 20881 25165263 ~ 25177225 (-) True XLOC_001237
TCONS_00002002 mRNA upstream 178063 25322445 ~ 25370281 (-) True XLOC_001238
TCONS_00002003 mRNA upstream 255132 25399514 ~ 25438737 (-) False XLOC_001239
TCONS_00002004 mRNA upstream 256960 25401342 ~ 25438934 (-) True XLOC_001239
TCONS_00001997 other downstream 318701 24825147 ~ 24825263 (-) True XLOC_001235
TCONS_00001977 other downstream 1802274 23340971 ~ 23341690 (-) False XLOC_001223
TCONS_00001976 other downstream 1803461 23339964 ~ 23340503 (-) False XLOC_001223
TCONS_00001973 other downstream 1813898 23323002 ~ 23330066 (-) False XLOC_001223
TCONS_00001939 other downstream 2469351 22663723 ~ 22674613 (-) True XLOC_001211
TCONS_00002010 other upstream 411343 25555725 ~ 25557930 (-) False XLOC_001242
TCONS_00002015 other upstream 531315 25675697 ~ 25676340 (-) True XLOC_001244
TCONS_00002016 other upstream 565431 25709813 ~ 25711803 (-) True XLOC_001245
TCONS_00002024 other upstream 773892 25918274 ~ 25936641 (-) True XLOC_001249
TCONS_00002039 other upstream 907099 26051481 ~ 26063159 (-) True XLOC_001254

Expression Profile

//