RNA id: TCONS_00004186



Basic Information


Item Value
RNA id TCONS_00004186
length 613
RNA type mRNA
GC content 0.51
exon number 2
gene id XLOC_002172
representative True

Chromosome Information


Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 26689262 ~ 26692647 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


CGCCGATCAGACCGGATTCAGCCGCGCGGGATACACTGTGGTCGCGGTGATTTTGGGAATAATCTTTGTTTTCGGTTTCCTTTGTAACTTTGTCGTTCTTTTGGTGTTCGCTCGTTTTCATGTACTGAGGACCCCGATTAACTTGATACTGTTGAATATCATTGTGAGCGATATGCTGGTTTGTCTGTTCGGTACACCTTTAAGTTTCGCCGCGTCTGTTCACGGCCGGTGGCTGACGGGAGTTCACGGATGCAGGTGGTATGGTTTTGCCAACGCGTTGTTCGGTATCGTTTCACTGGTATCTCTTGCTGTGCTGTCATACGAGCGTTATAGTACCATCCTCTGCTCCTCAAAAGCAGATGCATCTGACTATAGGAAGGCCTGGCTCTTCATCACAGGCTGCTGGCTGTACTCTCTGCTATGGACTGTACCACCGCTCTTAGGCTGGAGCAGCTATGGTCCTGAGGGTCCCGGCACCACCTGTTCAGTCCAGTGGAACAAGCGCTCTCCGGAAACCCGGTCTTACGTCATCTGCCTCTTTGTCTTCTGTCTTCTGCTGCCTCTCCTTCTGATGGTCTACTGCTATGGCAAGATCCTCATTGCCATTCATGGG

Function


GO:

id name namespace
GO:0007186 G protein-coupled receptor signaling pathway biological_process
GO:0050896 response to stimulus biological_process
GO:0007601 visual perception biological_process
GO:0007602 phototransduction biological_process
GO:0018298 protein-chromophore linkage biological_process
GO:0071482 cellular response to light stimulus biological_process
GO:0007165 signal transduction biological_process
GO:0001750 photoreceptor outer segment cellular_component
GO:0005887 integral component of plasma membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0009881 photoreceptor activity molecular_function
GO:0004930 G protein-coupled receptor activity molecular_function
GO:0008020 G protein-coupled photoreceptor activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-311 Predicted to enable G protein-coupled photoreceptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway; cellular response to light stimulus; and phototransduction. Predicted to act upstream of or within protein-chromophore linkage; signal transduction; and visual perception. Predicted to be located in membrane. Predicted to be integral component of membrane. Predicted to be active in photoreceptor outer segment. Predicted to be integral component of plasma membrane. Is expressed in several structures, including endocrine system; eye; gill; heart; and integument.

Ensembl:

ensembl_id ENSDART00000132946

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00005715 lncRNA upstream 60045 26628793 ~ 26629282 (+) True XLOC_002167
TCONS_00004176 lncRNA upstream 71722 26612321 ~ 26617605 (+) False XLOC_002166
TCONS_00005714 lncRNA upstream 124806 26564221 ~ 26564521 (+) True XLOC_002164
TCONS_00004172 lncRNA upstream 150690 26531877 ~ 26538637 (+) True XLOC_002163
TCONS_00005901 lncRNA upstream 416179 26269060 ~ 26273148 (+) True XLOC_002161
TCONS_00004188 lncRNA downstream 75434 26766385 ~ 26771677 (+) True XLOC_002174
TCONS_00005716 lncRNA downstream 95418 26786369 ~ 26786785 (+) True XLOC_002175
TCONS_00005717 lncRNA downstream 191751 26882702 ~ 26883139 (+) True XLOC_002181
TCONS_00004206 lncRNA downstream 282650 26973601 ~ 26976954 (+) True XLOC_002186
TCONS_00005902 lncRNA downstream 370810 27061761 ~ 27064405 (+) False XLOC_002190
TCONS_00004184 mRNA upstream 11341 26669177 ~ 26677986 (+) True XLOC_002171
TCONS_00004183 mRNA upstream 11384 26667483 ~ 26677943 (+) False XLOC_002171
TCONS_00004182 mRNA upstream 11491 26667475 ~ 26677836 (+) False XLOC_002171
TCONS_00004181 mRNA upstream 22084 26652859 ~ 26667243 (+) True XLOC_002170
TCONS_00004180 mRNA upstream 37402 26646104 ~ 26651925 (+) True XLOC_002169
TCONS_00004187 mRNA downstream 56804 26747755 ~ 26757486 (+) True XLOC_002173
TCONS_00004189 mRNA downstream 109262 26800213 ~ 26811397 (+) True XLOC_002176
TCONS_00004190 mRNA downstream 122759 26813710 ~ 26822190 (+) True XLOC_002177
TCONS_00004191 mRNA downstream 136162 26827113 ~ 26832044 (+) True XLOC_002178
TCONS_00004192 mRNA downstream 144034 26834985 ~ 26837173 (+) True XLOC_002179
TCONS_00004170 other upstream 382984 26306229 ~ 26306343 (+) True XLOC_002162
TCONS_00004166 other upstream 724928 25964284 ~ 25964399 (+) True XLOC_002158
TCONS_00004165 other upstream 728579 25948242 ~ 25960748 (+) True XLOC_002157
TCONS_00004149 other upstream 2016398 24668774 ~ 24672929 (+) False XLOC_002143
TCONS_00004147 other upstream 2024878 24660142 ~ 24664449 (+) False XLOC_002143
TCONS_00004210 other downstream 372223 27063174 ~ 27063257 (+) False XLOC_002190
TCONS_00004211 other downstream 372403 27063354 ~ 27063438 (+) True XLOC_002190
TCONS_00004216 other downstream 1469346 28160297 ~ 28162247 (+) True XLOC_002194
TCONS_00004217 other downstream 1561727 28252678 ~ 28252795 (+) True XLOC_002196
TCONS_00004234 other downstream 2575840 29266791 ~ 29268413 (+) True XLOC_002204

Expression Profile


//