RNA id: TCONS_00000615


Basic Information

Item Value
RNA id TCONS_00000615
length 687
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_000359
representative False

Chromosome Information

Item Value
chromosome id NC_007112.7
NCBI id CM002885.2
chromosome length 59578282
location 30083578 ~ 30310689 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGACGGATCCTGCAAGCGTACCCTTGTTGGCTTGGCAGTTTGTGGCTGCACAGAAAGCAATCAACCCAGTTCTGGCTTTCTGTAGAGGAGACACCATCCACTTCCTACTGGTTAAAAAAGACGAGTCTGGCACCATCCATGTCATCAAACAAAGGCAGCTTCAACTAAACTGTGACCTAATCAGTCTGAGCTGGATAAACCCCCGGACGCTTGTGTTGATGGACAGCACAGAAAAACTGCGAGTGGTGGACAGACCCAGTCAGGAGGAGCTGGAAACCGTGGACATGGCTGAGCTTCAGCTGGTATACAATAGCAGCCATTTCAAATCCCTCGCCACTGGTGGAAATGTCAGCCAAGCACTGGCTCTAGTTGGAGAAAAGACATGTTACCAGTCTGTTTGCAGCTATGCGGGCCAGATTATGTATCTTGGAACAAAGTGACATCTGCTCATCGTGGGATTACGGCAGAGGCTCATGGGAGAAAGCTTGCTGTTCTGACAGAACTCACCCATTCGCATGGCACTGAGAGGGCCGGTTTGTCAAACCCTGCCCATCCAGGAACAGGAAGCATTTACCACAGCGAGAACTTTCAGTTAAAGCTCACTCCTCCGCCACTGGTGGAGGAATAGATGACTCCGTCCACTGTTACCAATCTTAATAAAGCACTACCATGTCTGTACAGAAATAA

Function

GO:

id name namespace
GO:0006886 intracellular protein transport biological_process
GO:0006623 protein targeting to vacuole biological_process
GO:0016192 vesicle-mediated transport biological_process
GO:0034058 endosomal vesicle fusion biological_process
GO:0005770 late endosome cellular_component
GO:0005575 cellular_component cellular_component
GO:0030897 HOPS complex cellular_component
GO:0046872 metal ion binding molecular_function

KEGG:

id description
ko04138 Autophagy - yeast
ko04131 Membrane trafficking

ZFIN:

id description
ZDB-GENE-060503-348 Predicted to enable metal ion binding activity. Predicted to be involved in endosomal vesicle fusion and protein targeting to vacuole. Predicted to act upstream of or within intracellular protein transport and vesicle-mediated transport. Predicted to be part of HOPS complex. Predicted to be active in late endosome. Orthologous to human VPS8 (VPS8 subunit of CORVET complex).

Ensembl:

ensembl_id ENSDART00000134311

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003081 lncRNA upstream 20728 30074635 ~ 30079529 (+) False XLOC_000358
TCONS_00002844 lncRNA upstream 20728 30074710 ~ 30079529 (+) False XLOC_000358
TCONS_00002843 lncRNA upstream 20728 30074734 ~ 30079529 (+) True XLOC_000358
TCONS_00000607 lncRNA upstream 290761 29806494 ~ 29809496 (+) True XLOC_000355
TCONS_00000598 lncRNA upstream 591784 29507647 ~ 29508473 (+) True XLOC_000350
TCONS_00000621 lncRNA downstream 412691 30723380 ~ 30727619 (+) False XLOC_000364
TCONS_00000626 lncRNA downstream 543280 30853969 ~ 30857925 (+) False XLOC_000365
TCONS_00002845 lncRNA downstream 544701 30855390 ~ 30859524 (+) True XLOC_000365
TCONS_00000630 lncRNA downstream 743726 31054415 ~ 31055182 (+) False XLOC_000367
TCONS_00003082 lncRNA downstream 830430 31141119 ~ 31144527 (+) False XLOC_000369
TCONS_00000610 mRNA upstream 146511 29862074 ~ 29953746 (+) False XLOC_000357
TCONS_00000612 mRNA upstream 223613 29862133 ~ 29876644 (+) True XLOC_000357
TCONS_00000611 mRNA upstream 224233 29862082 ~ 29876024 (+) False XLOC_000357
TCONS_00000609 mRNA upstream 239362 29858032 ~ 29860895 (+) True XLOC_000356
TCONS_00000606 mRNA upstream 275882 29798140 ~ 29824375 (+) False XLOC_000355
TCONS_00000619 mRNA downstream 111454 30422143 ~ 30438036 (+) True XLOC_000362
TCONS_00000620 mRNA downstream 241088 30551777 ~ 30554973 (+) True XLOC_000363
TCONS_00000622 mRNA downstream 412691 30723380 ~ 30728007 (+) False XLOC_000364
TCONS_00000623 mRNA downstream 412769 30723458 ~ 30734796 (+) False XLOC_000364
TCONS_00000624 mRNA downstream 412772 30723461 ~ 30734363 (+) False XLOC_000364
TCONS_00000608 other upstream 239884 29831759 ~ 29860373 (+) False XLOC_000356
TCONS_00000579 other upstream 1019921 29068662 ~ 29080336 (+) False XLOC_000337
TCONS_00000565 other upstream 2098320 27977370 ~ 28001937 (+) False XLOC_000332
TCONS_00000567 other upstream 2104646 27984393 ~ 27995611 (+) True XLOC_000332
TCONS_00000557 other upstream 2369277 27713349 ~ 27730980 (+) False XLOC_000329
TCONS_00000628 other downstream 645236 30955925 ~ 30965004 (+) True XLOC_000366
TCONS_00000632 other downstream 746551 31057240 ~ 31063850 (+) True XLOC_000367
TCONS_00000645 other downstream 1395980 31706669 ~ 31722875 (+) True XLOC_000376
TCONS_00000653 other downstream 1740924 32051613 ~ 32065030 (+) False XLOC_000384
TCONS_00000657 other downstream 2203300 32513989 ~ 32514104 (+) True XLOC_000386

Expression Profile

//