G214496


Basic Information

Item Value
gene id G214496
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 3728533 ~ 3728810 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU243369
CTAATATGAGCACATTGTGTCAAATAATTATTGAAAAATGACCAGAGACACATATACACACACCGATCAGGCATAACATTATGAGCACCTTCCTAATATTGTGTTGGTCCTCCTTTTGCTGCCAAAACAGCCCTGACCCGTCGAGGCATGGACTCCACTAGACCCCTGAAGGTGTGCTGTGGTATCTGCACCAAGATGTTAGCAGCAGATCCTTTAAGTCCTGTAAGTTGCAAGGTGGAGCATCCATGGATCGGACTTGTTTGTTCAGCACATCCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU243369 True 278 lncRNA 0.46 1 3728533 3728810

Neighbor

gene id symbol gene type direction distance location
CI01000050_03679119_03683710 NA coding upstream 44364 3679080 ~ 3684169 (+)
CI01000050_03641769_03645039 NA coding upstream 83424 3639187 ~ 3645109 (+)
CI01000050_03599274_03618237 SLC25A37 coding upstream 109493 3599274 ~ 3619040 (+)
CI01000050_03573096_03586434 ENTPD4 coding upstream 141222 3573096 ~ 3587311 (+)
CI01000050_03557372_03567755 CHMP7 coding upstream 160554 3557327 ~ 3567979 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 coding downstream 78887 3805143 ~ 3808870 (+)
CI01000050_03814516_03818892 NA coding downstream 84610 3813420 ~ 3818939 (+)
CI01000050_03938328_03956122 RHOBTB2 coding downstream 209518 3931890 ~ 3957044 (+)
CI01000050_03989489_04121180 NA coding downstream 259447 3988257 ~ 4121393 (+)
CI01000050_04122649_04127014 EGR3 coding downstream 393839 4122649 ~ 4127045 (+)
G213153 NA non-coding upstream 55656 3671892 ~ 3672877 (+)
G213113 NA non-coding upstream 177953 3550198 ~ 3550580 (+)
G213074 NA non-coding upstream 183422 3446464 ~ 3545111 (+)
G213019 NA non-coding upstream 516679 3211584 ~ 3211854 (+)
G213016 NA non-coding upstream 526891 3199786 ~ 3201642 (+)
G214500 NA non-coding downstream 3158 3731968 ~ 3732173 (+)
G214501 NA non-coding downstream 9381 3738191 ~ 3738542 (+)
G214503 NA non-coding downstream 24232 3753042 ~ 3753268 (+)
G214506 NA non-coding downstream 29565 3758375 ~ 3762523 (+)
CI01000050_02852118_02864754 RNF122 other upstream 862711 2852118 ~ 2865822 (+)
G212927 NA other upstream 953400 2774839 ~ 2775133 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other upstream 2031125 1691374 ~ 1698973 (+)
CI01000050_01296683_01297763 SELENOK other upstream 2428927 1296365 ~ 1298255 (+)
G212184 NA other upstream 3294327 433684 ~ 434206 (+)
G214717 NA other downstream 378772 4107582 ~ 4108280 (+)
CI01000050_04591548_04592778 NA other downstream 862745 4589926 ~ 4593049 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other downstream 1678775 5407585 ~ 5409417 (+)

Expression


Co-expression Network