G213016


Basic Information

Item Value
gene id G213016
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 3199786 ~ 3201642 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU241637
ATAAGATCAAGAGTCAAACTTTACTAGAGAATCCAATGGAACATACAGGAACACAGGAGATACACACTTACATCAAACGACAACCGACAAACACAAGTGATAAGGGTGACTGTTTATATAGTGAGTCCAGATGAGTGATAATGATGATGATTGCCTTCAGGTGCGGGTGATGGTGATGACGTGTAGGTGCAGGGCAGAGGGAATGCTGGGAAGTGTAGTGCAGGAACCGGTGACT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU241637 True 235 lncRNA 0.45 2 3199786 3201642

Neighbor

gene id symbol gene type direction distance location
CI01000050_03129712_03134758 TBX16 coding upstream 64823 3129712 ~ 3134963 (+)
CI01000050_02995539_03115563 CABIN1 coding upstream 83708 2995539 ~ 3116078 (+)
CI01000050_02978801_02980782 CEP78 coding upstream 219004 2978801 ~ 2980782 (+)
CI01000050_02878198_02942065 VPS13A coding upstream 257051 2878198 ~ 2942735 (+)
CI01000050_02852118_02864754 RNF122 coding upstream 334889 2852118 ~ 2865822 (+)
CI01000050_03224108_03230670 NA coding downstream 22415 3224057 ~ 3231161 (+)
CI01000050_03238081_03239214 NPY8BR coding downstream 36075 3237717 ~ 3239314 (+)
CI01000050_03272821_03284544 KCTD9, KCTD9A coding downstream 70577 3272219 ~ 3284762 (+)
CI01000050_03306831_03324064 NA coding downstream 105189 3306831 ~ 3324244 (+)
CI01000050_03392003_03421994 FGFR1A, FGFR1 coding downstream 190361 3392003 ~ 3422913 (+)
G213000 NA non-coding upstream 9047 3190519 ~ 3190739 (+)
G212988 NA non-coding upstream 24787 3174704 ~ 3174999 (+)
G212986 NA non-coding upstream 26832 3172624 ~ 3172954 (+)
G212985 NA non-coding upstream 31589 3167767 ~ 3168197 (+)
G212980 NA non-coding upstream 41331 3158126 ~ 3158455 (+)
G213019 NA non-coding downstream 9942 3211584 ~ 3211854 (+)
G213074 NA non-coding downstream 244822 3446464 ~ 3545111 (+)
G213113 NA non-coding downstream 348556 3550198 ~ 3550580 (+)
G213153 NA non-coding downstream 470250 3671892 ~ 3672877 (+)
G214496 NA non-coding downstream 526891 3728533 ~ 3728810 (+)
G212927 NA other upstream 424653 2774839 ~ 2775133 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other upstream 1502378 1691374 ~ 1698973 (+)
CI01000050_01296683_01297763 SELENOK other upstream 1900180 1296365 ~ 1298255 (+)
G212184 NA other upstream 2765580 433684 ~ 434206 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other downstream 603501 3805143 ~ 3808870 (+)
CI01000050_03938328_03956122 RHOBTB2 other downstream 748960 3931890 ~ 3957044 (+)
G214717 NA other downstream 905940 4107582 ~ 4108280 (+)
CI01000050_04591548_04592778 NA other downstream 1389913 4589926 ~ 4593049 (+)
CI01000050_05407682_05409108 FKBP1B, FKBP1AA, FKBP1AB, FKBP1A, FKB1B, FKB1A other downstream 2205943 5407585 ~ 5409417 (+)

Expression


Co-expression Network