RNA id: TCONS_00003852


Basic Information

Item Value
RNA id TCONS_00003852
length 708
RNA type mRNA
GC content 0.56
exon number 2
gene id XLOC_001970
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 13279079 ~ 13287169 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGAGGGGCTTTTACTCCAAGCTGGACTCCTCATCTATAGGTATGGCTGTGCCTCTGAATCTGGCCGTGGAGACAGAGAAAGCGCAGGCGCTCCTCCAGACCTTCAGCACTGCCTCTCTGTTCGCCAGCGCAGGCCTAGGCGCTTTCTGTTTCGTCGCTGACCACTTCCTGACGCTACCCTTCATCCAGCATCATCTGTGGCTCAGGGCTCTTTTCGATAACACTGTCCACGCCATCATTGGTCTGTGGTCTTGGGCCATCGTGATCGGCTTGAGGAAGAAAAGTGACTTCTATGAAGTCATCCTGGCCGGGTTTCTGGCCTCGGTCATTGACCTGGACCACTTCTACATGGCTGGATCATTGTCAATCAAAGCTGCTGTGAATCTGCCACACAGGCCTCCTCTGCACTGCTCTACCTTGATCCCAGCGCTCTGCTTCTCTCTGCGCCTCCTCATGTGGGCCTGCCGGCTCAAAGACTCCTGGTGCTCTCTGCCCTGGATGCTTTTCATCTCGCTGACATCGCACCACATCCGGGACGGGGTTCGCCACGGCCTCTGGGTCTGTCCATTCGGCAACACAGCACCAATCTCATACTGGCTGTACGTAACCATTACAGCCACACTCCCTCATCTGTGCTCAGTGCTCATGTATCTGACCGGCACCAGAGACATGATCTCCACCAAACACGGCGTCGCTATTGACGTCTGA

Function

GO:

id name namespace
GO:0008150 biological_process biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030616-546 Predicted to be located in membrane. Predicted to be integral component of membrane. Orthologous to human TMEM267 (transmembrane protein 267).

Ensembl:

ensembl_id ENSDART00000186615

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005692 lncRNA upstream 1354436 11928089 ~ 11929132 (+) False XLOC_001965
TCONS_00005691 lncRNA upstream 1354436 11928089 ~ 11929132 (+) True XLOC_001965
TCONS_00005690 lncRNA upstream 1355582 11926073 ~ 11927986 (+) False XLOC_001964
TCONS_00005689 lncRNA upstream 1355582 11926073 ~ 11927986 (+) True XLOC_001964
TCONS_00005836 lncRNA upstream 1617605 11652749 ~ 11665963 (+) True XLOC_001961
TCONS_00005837 lncRNA downstream 12156 13298724 ~ 13304277 (+) False XLOC_001971
TCONS_00005838 lncRNA downstream 12158 13298726 ~ 13304277 (+) True XLOC_001971
TCONS_00005839 lncRNA downstream 1738213 15024781 ~ 15031440 (+) False XLOC_001979
TCONS_00005840 lncRNA downstream 1738424 15024992 ~ 15031440 (+) False XLOC_001979
TCONS_00005841 lncRNA downstream 1738461 15025029 ~ 15031440 (+) True XLOC_001979
TCONS_00003849 mRNA upstream 47556 13209580 ~ 13236012 (+) False XLOC_001969
TCONS_00003850 mRNA upstream 60703 13209690 ~ 13222865 (+) True XLOC_001969
TCONS_00003848 mRNA upstream 219458 13000704 ~ 13064110 (+) True XLOC_001968
TCONS_00003846 mRNA upstream 219825 13000370 ~ 13063743 (+) False XLOC_001968
TCONS_00003847 mRNA upstream 245026 13000669 ~ 13038542 (+) False XLOC_001968
TCONS_00003855 mRNA downstream 924099 14210667 ~ 14212801 (+) True XLOC_001974
TCONS_00003856 mRNA downstream 1202057 14488625 ~ 14494239 (+) True XLOC_001975
TCONS_00003857 mRNA downstream 1212633 14499201 ~ 14521190 (+) True XLOC_001976
TCONS_00003858 mRNA downstream 1660435 14947003 ~ 14949367 (+) True XLOC_001977
TCONS_00003860 mRNA downstream 1677330 14963898 ~ 15017639 (+) False XLOC_001978
TCONS_00003844 other upstream 950199 12333253 ~ 12333369 (+) True XLOC_001966
TCONS_00003843 other upstream 1509049 11774405 ~ 11774519 (+) True XLOC_001963
TCONS_00003841 other upstream 1784759 11498693 ~ 11498809 (+) True XLOC_001959
TCONS_00003830 other upstream 2167598 11115854 ~ 11115970 (+) True XLOC_001954
TCONS_00003827 other upstream 2296266 10972810 ~ 10987302 (+) False XLOC_001952
TCONS_00003853 other downstream 570224 13856792 ~ 13894856 (+) True XLOC_001972
TCONS_00003854 other downstream 644280 13930848 ~ 13931718 (+) True XLOC_001973
TCONS_00003873 other downstream 1968614 15255182 ~ 15287900 (+) False XLOC_001989
TCONS_00003878 other downstream 2012222 15298790 ~ 15304367 (+) True XLOC_001989
TCONS_00003893 other downstream 2316516 15603084 ~ 15605143 (+) False XLOC_001994

Expression Profile

//