RNA id: TCONS_00004309


Basic Information

Item Value
RNA id TCONS_00004309
length 486
RNA type mRNA
GC content 0.53
exon number 4
gene id XLOC_002253
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 33895315 ~ 33999781 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CTGCAGCAAATGGAAACTCTGGCTCAATTGGAGTTGTGTCAGCGACTATACAAACTTCACTTCCAGCTCCTTCTGCTGTTTCAGTCCTATTGTAAACTTATCGGACAAGTGAACACCATCAGCTCTGTGCCGGAGCTGTGGAACATGTCTCGTGAGCTGAGCGATCTGAAAAACTGCCTGCGTTTGGCTGAAGCTTCGTTAGCAGGTGATCTAGAAGACCGCCATAGGCACGGCTCGCAGTCCATCTTCTCCAGCTCAGAGACAGCCGTACAAGCCATCCTGGAGTGCTTGAACAACAACGACTTCTCCATGGCCATCCGCTACACTCAAGAGTGCAGACGAATATGGCCAAACGACATCTTCGGCGGTGGCTCCGAGGACGAAATCCAGACTCTCCTCAACGTCTACTTCCGTCACCAGACCATCGGCCAGACTGGCACCTTCGCTCTGGTGGGCTCCAACAAGGACATGTCAGAGGTCTGCACA

Function

GO:

id name namespace
GO:0000902 cell morphogenesis biological_process
GO:0031175 neuron projection development biological_process
GO:0030427 site of polarized growth cellular_component
GO:0005938 cell cortex cellular_component

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-080215-5 Predicted to be involved in cell morphogenesis and neuron projection development. Predicted to be active in cell cortex and site of polarized growth. Is expressed in several structures, including EVL; myotome; nervous system; notochord; and periderm. Orthologous to human FRY (FRY microtubule binding protein).

Ensembl:

ensembl_id ENSDART00000138547

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005725 lncRNA upstream 119560 33870189 ~ 33871012 (+) True XLOC_002252
TCONS_00005724 lncRNA upstream 622407 33363402 ~ 33368165 (+) True XLOC_002245
TCONS_00004293 lncRNA upstream 626464 33362166 ~ 33364108 (+) False XLOC_002245
TCONS_00005723 lncRNA upstream 627992 33360328 ~ 33362580 (+) False XLOC_002245
TCONS_00005916 lncRNA downstream 60391 34057291 ~ 34058317 (+) False XLOC_002256
TCONS_00005917 lncRNA downstream 193642 34190542 ~ 34193306 (+) True XLOC_002261
TCONS_00005918 lncRNA downstream 242160 34239060 ~ 34239838 (+) True XLOC_002263
TCONS_00005919 lncRNA downstream 1057411 35054311 ~ 35058561 (+) True XLOC_002269
TCONS_00004341 lncRNA downstream 1156041 35152941 ~ 35156528 (+) False XLOC_002270
TCONS_00004307 mRNA upstream 78369 33902264 ~ 33912203 (+) False XLOC_002253
TCONS_00004304 mRNA upstream 123146 33744098 ~ 33867426 (+) False XLOC_002251
TCONS_00004305 mRNA upstream 123760 33754967 ~ 33866812 (+) True XLOC_002251
TCONS_00004301 mRNA upstream 280345 33626344 ~ 33710227 (+) False XLOC_002250
TCONS_00004310 mRNA downstream 4544 34001444 ~ 34021856 (+) False XLOC_002254
TCONS_00004312 mRNA downstream 13594 34010494 ~ 34026125 (+) False XLOC_002254
TCONS_00004311 mRNA downstream 13594 34010494 ~ 34026125 (+) True XLOC_002254
TCONS_00004314 mRNA downstream 50452 34047352 ~ 34104483 (+) False XLOC_002256
TCONS_00004317 mRNA downstream 94863 34091763 ~ 34104491 (+) True XLOC_002256
TCONS_00004303 other upstream 280352 33702442 ~ 33710220 (+) True XLOC_002250
TCONS_00004290 other upstream 988139 33002319 ~ 33002433 (+) True XLOC_002241
TCONS_00004283 other upstream 1594676 32395780 ~ 32395896 (+) True XLOC_002235
TCONS_00004273 other upstream 2297796 31692662 ~ 31692776 (+) True XLOC_002225
TCONS_00004262 other upstream 3230528 30759929 ~ 30760044 (+) True XLOC_002218
TCONS_00004313 other downstream 38789 34035689 ~ 34043319 (+) True XLOC_002255
TCONS_00004315 other downstream 50460 34047360 ~ 34058765 (+) False XLOC_002256
TCONS_00004316 other downstream 70979 34067879 ~ 34086349 (+) False XLOC_002256
TCONS_00004318 other downstream 111641 34108541 ~ 34120301 (+) True XLOC_002257
TCONS_00004319 other downstream 127521 34124421 ~ 34147245 (+) True XLOC_002258

Expression Profile

//