RNA id: TCONS_00004307


Basic Information

Item Value
RNA id TCONS_00004307
length 567
RNA type mRNA
GC content 0.49
exon number 6
gene id XLOC_002253
representative False

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 33895315 ~ 33999781 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGCCGGTCACTGTGGACCCAGAGAGCAAACCGGGCGAGTATGTCCTCAAAAGCCTGTTCGCCAACTTCACCACCTTGTCAGAACGCAAAATACGCATCATCATGGCAGAACCACTGGAAAAGCCCCTCACCAAATCTCTACAGAGAGGAGAGGACCCGCAGTTTGACCAGCTGATCAGCACCATGAGCTCTCTTGCCGAGTATTGTCTTCCGTCCATCCTGCGGACACTGTTTGACTGGTATAAAAGACAGAACGGTTTGGAAGACGAGTCCCATGAATATCGGCCACGTGCAAACACCAAGTCCAAAAATGATGAACAGCAGAAAGATTATCTGATGGAGAGGAGGGATTTGGCAATCGATTTCATATTCTCGCTGGTGCTTATTGAAGTTTTAAAACAGATCCCTCTCCATCCTCTCCTGGATGGCCTCATTCAGGAAGTCATTAACCTGGCCTTCAAACACTTCAAGTACAAAGAGGGGTACCTTGGACCCAACACGACCAACATGCACATAGTGGCCGATCTGTATGCAGAGGTTGTCGGTGTCGTTGCTCAGTCCAGGTAA

Function

GO:

id name namespace
GO:0000902 cell morphogenesis biological_process
GO:0031175 neuron projection development biological_process
GO:0030427 site of polarized growth cellular_component
GO:0005938 cell cortex cellular_component

KEGG:

id description
ko02000 Transporters

ZFIN:

id description
ZDB-GENE-080215-5 Predicted to be involved in cell morphogenesis and neuron projection development. Predicted to be active in cell cortex and site of polarized growth. Is expressed in several structures, including EVL; myotome; nervous system; notochord; and periderm. Orthologous to human FRY (FRY microtubule binding protein).

Ensembl:

ensembl_id ENSDART00000193793

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005725 lncRNA upstream 31252 33870189 ~ 33871012 (+) True XLOC_002252
TCONS_00005724 lncRNA upstream 534099 33363402 ~ 33368165 (+) True XLOC_002245
TCONS_00004293 lncRNA upstream 538156 33362166 ~ 33364108 (+) False XLOC_002245
TCONS_00005723 lncRNA upstream 539684 33360328 ~ 33362580 (+) False XLOC_002245
TCONS_00005916 lncRNA downstream 145088 34057291 ~ 34058317 (+) False XLOC_002256
TCONS_00005917 lncRNA downstream 278339 34190542 ~ 34193306 (+) True XLOC_002261
TCONS_00005918 lncRNA downstream 326857 34239060 ~ 34239838 (+) True XLOC_002263
TCONS_00005919 lncRNA downstream 1142108 35054311 ~ 35058561 (+) True XLOC_002269
TCONS_00004341 lncRNA downstream 1240738 35152941 ~ 35156528 (+) False XLOC_002270
TCONS_00004304 mRNA upstream 34838 33744098 ~ 33867426 (+) False XLOC_002251
TCONS_00004305 mRNA upstream 35452 33754967 ~ 33866812 (+) True XLOC_002251
TCONS_00004301 mRNA upstream 192037 33626344 ~ 33710227 (+) False XLOC_002250
TCONS_00004302 mRNA upstream 192346 33627429 ~ 33709918 (+) False XLOC_002250
TCONS_00004300 mRNA upstream 308154 33588715 ~ 33594110 (+) True XLOC_002249
TCONS_00004308 mRNA downstream 69807 33982010 ~ 33999781 (+) False XLOC_002253
TCONS_00004309 mRNA downstream 78369 33990572 ~ 33996900 (+) True XLOC_002253
TCONS_00004310 mRNA downstream 89241 34001444 ~ 34021856 (+) False XLOC_002254
TCONS_00004312 mRNA downstream 98291 34010494 ~ 34026125 (+) False XLOC_002254
TCONS_00004311 mRNA downstream 98291 34010494 ~ 34026125 (+) True XLOC_002254
TCONS_00004303 other upstream 192044 33702442 ~ 33710220 (+) True XLOC_002250
TCONS_00004290 other upstream 899831 33002319 ~ 33002433 (+) True XLOC_002241
TCONS_00004283 other upstream 1506368 32395780 ~ 32395896 (+) True XLOC_002235
TCONS_00004273 other upstream 2209488 31692662 ~ 31692776 (+) True XLOC_002225
TCONS_00004262 other upstream 3142220 30759929 ~ 30760044 (+) True XLOC_002218
TCONS_00004313 other downstream 123486 34035689 ~ 34043319 (+) True XLOC_002255
TCONS_00004315 other downstream 135157 34047360 ~ 34058765 (+) False XLOC_002256
TCONS_00004316 other downstream 155676 34067879 ~ 34086349 (+) False XLOC_002256
TCONS_00004318 other downstream 196338 34108541 ~ 34120301 (+) True XLOC_002257
TCONS_00004319 other downstream 212218 34124421 ~ 34147245 (+) True XLOC_002258

Expression Profile

//