RNA id: TCONS_00007712


Basic Information

Item Value
RNA id TCONS_00007712
length 319
RNA type mRNA
GC content 0.45
exon number 3
gene id XLOC_004044
representative False

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 14955484 ~ 15001712 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AGATCGTTGCGTGAAAGTGGGTTTGCCATCTGCCATAAAATATCATTAGAAGAAGAAAGTCGCGTGGATTAGACTGAACATTAGAAGCTGTAAAGTGTCTACATGGCCGTCAGAAGAGGACACATAAGGTATTTGAAACAGGAAGTATACGATATGCCGAATGGTTATGAGGACCCCATGGGCGATGAGCCAAGTGATGCCAAAACCAACCTGATCATCAACTACCTACCCCAGAATATGAGTCAGGAGGAACTTCGGAGTCTCTTCAGCAGCATTGGAGAGGTGGAGTCAGCCAAACTCATTAGAGACAAGATGGCAG

Function

GO:

id name namespace
GO:1990904 ribonucleoprotein complex cellular_component
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-000210-17 Enables mRNA 3'-UTR binding activity. Predicted to be located in viral nucleocapsid. Predicted to be part of ribonucleoprotein complex. Orthologous to human ELAVL1 (ELAV like RNA binding protein 1).

Ensembl:

ensembl_id ENSDART00000168180

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008781 lncRNA downstream 115244 14873329 ~ 14874130 (-) True XLOC_004042
TCONS_00007702 lncRNA downstream 160050 14827374 ~ 14829324 (-) True XLOC_004041
TCONS_00008780 lncRNA downstream 230286 14754905 ~ 14759088 (-) True XLOC_004039
TCONS_00008779 lncRNA downstream 230294 14754905 ~ 14759080 (-) False XLOC_004039
TCONS_00007698 lncRNA downstream 293510 14693481 ~ 14695864 (-) True XLOC_004038
TCONS_00007715 lncRNA upstream 16458 15018138 ~ 15019527 (-) True XLOC_004045
TCONS_00007722 lncRNA upstream 268127 15269807 ~ 15281902 (-) False XLOC_004047
TCONS_00008460 lncRNA upstream 309701 15311381 ~ 15313599 (-) True XLOC_004048
TCONS_00008782 lncRNA upstream 755046 15756726 ~ 15761871 (-) True XLOC_004050
TCONS_00007728 lncRNA upstream 773772 15775452 ~ 15780923 (-) True XLOC_004051
TCONS_00007703 mRNA downstream 65236 14915780 ~ 14924138 (-) True XLOC_004043
TCONS_00007701 mRNA downstream 176311 14789022 ~ 14813063 (-) True XLOC_004040
TCONS_00007699 mRNA downstream 176345 14771908 ~ 14813029 (-) False XLOC_004040
TCONS_00007700 mRNA downstream 199456 14772598 ~ 14789918 (-) False XLOC_004040
TCONS_00007697 mRNA downstream 320348 14667066 ~ 14669026 (-) True XLOC_004037
TCONS_00007716 mRNA upstream 66627 15068307 ~ 15090564 (-) False XLOC_004046
TCONS_00007717 mRNA upstream 66936 15068616 ~ 15090118 (-) True XLOC_004046
TCONS_00007718 mRNA upstream 223854 15225534 ~ 15296805 (-) False XLOC_004047
TCONS_00007720 mRNA upstream 223928 15225608 ~ 15297210 (-) False XLOC_004047
TCONS_00007719 mRNA upstream 223928 15225608 ~ 15297210 (-) False XLOC_004047
TCONS_00007689 other downstream 1506587 13482671 ~ 13482787 (-) True XLOC_004029
TCONS_00007673 other downstream 2233099 12756143 ~ 12756275 (-) True XLOC_004024
TCONS_00007664 other downstream 2297683 12691395 ~ 12691691 (-) True XLOC_004019
TCONS_00007658 other downstream 2367607 12621518 ~ 12621767 (-) True XLOC_004015
TCONS_00007656 other downstream 2398078 12590999 ~ 12591296 (-) True XLOC_004013
TCONS_00007741 other upstream 1016203 16017883 ~ 16019615 (-) False XLOC_004058
TCONS_00007744 other upstream 1019249 16020929 ~ 16021471 (-) True XLOC_004058
TCONS_00007745 other upstream 1056511 16058191 ~ 16058307 (-) True XLOC_004059
TCONS_00007751 other upstream 1125702 16127382 ~ 16127678 (-) True XLOC_004063
TCONS_00007758 other upstream 1331144 16332824 ~ 16336886 (-) False XLOC_004066

Expression Profile

//