RNA id: TCONS_00007879


Basic Information

Item Value
RNA id TCONS_00007879
length 420
RNA type mRNA
GC content 0.44
exon number 5
gene id XLOC_004127
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 23327784 ~ 23332592 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAACCATGATCGCAATCACAGAGTTTCAGAAGATCGGTGTTGGTCTGTCAGGATTCGGCGTGTTCTTTGTGCTGTTTGGGATTCTGCTGTACTTTGACTCAGTCCTGTTGGCGTTTGGAAACATTCTGTTTCTGTCTGGTCTGGCCTTCATCATTGGTTTAAAAAGGACGGCACACTTCTTCTTCCAGAGGCAGAAGCTCAGAAGCTCCGCCTTCTTTCTGGGAGGCGTGGCTTTAGTACTGCTAAGATGGCCTCGTATTGGCATGTTAGTGGAGACATATGGCTTTGTGCTTCTATTCAAATCTTTCTTCCCAGTGGCTTTTGGTTTCCTTGCAACGGTTTTCAACATTCCCTTTTTAACAACGATTTTAAACAAGTTATCTGGTAGTAGTACATCAATGGTGTAAAAGCAGATTCTGG

Function

GO:

id name namespace
GO:0016192 vesicle-mediated transport biological_process
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component

KEGG: NA

ZFIN:

id description
ZDB-GENE-141212-320 Predicted to act upstream of or within vesicle-mediated transport. Predicted to be located in Golgi membrane. Predicted to be integral component of membrane. Orthologous to human GOLT1A (golgi transport 1A).

Ensembl:

ensembl_id ENSDART00000125024

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00007876 lncRNA downstream 18466 23305755 ~ 23309318 (-) False XLOC_004125
TCONS_00007875 lncRNA downstream 18466 23305755 ~ 23309318 (-) True XLOC_004125
TCONS_00007872 lncRNA downstream 246824 22993020 ~ 23080960 (-) True XLOC_004122
TCONS_00008468 lncRNA downstream 415671 22909764 ~ 22912113 (-) True XLOC_004121
TCONS_00008467 lncRNA downstream 421884 22905199 ~ 22905900 (-) False XLOC_004121
TCONS_00008793 lncRNA upstream 165673 23498265 ~ 23501763 (-) False XLOC_004128
TCONS_00008794 lncRNA upstream 165673 23498265 ~ 23525611 (-) True XLOC_004128
TCONS_00007889 lncRNA upstream 567408 23900000 ~ 23901361 (-) False XLOC_004131
TCONS_00007890 lncRNA upstream 567817 23900409 ~ 23901345 (-) True XLOC_004131
TCONS_00007894 lncRNA upstream 682644 24015236 ~ 24016385 (-) False XLOC_004132
TCONS_00007878 mRNA downstream 5602 23312176 ~ 23322182 (-) True XLOC_004126
TCONS_00007877 mRNA downstream 13542 23311452 ~ 23314242 (-) False XLOC_004126
TCONS_00007874 mRNA downstream 108417 23205889 ~ 23219367 (-) True XLOC_004124
TCONS_00007869 mRNA downstream 301835 22926943 ~ 23025949 (-) False XLOC_004122
TCONS_00007880 mRNA upstream 10404 23342996 ~ 23458792 (-) False XLOC_004128
TCONS_00007882 mRNA upstream 14966 23347558 ~ 23459779 (-) False XLOC_004128
TCONS_00007881 mRNA upstream 14966 23347558 ~ 23459779 (-) False XLOC_004128
TCONS_00007883 mRNA upstream 14966 23347558 ~ 23501467 (-) False XLOC_004128
TCONS_00007884 mRNA upstream 15714 23348306 ~ 23459779 (-) False XLOC_004128
TCONS_00007873 other downstream 168477 23159189 ~ 23159307 (-) True XLOC_004123
TCONS_00007863 other downstream 728229 22597114 ~ 22599555 (-) True XLOC_004120
TCONS_00007852 other downstream 1575195 21752475 ~ 21752589 (-) True XLOC_004115
TCONS_00007850 other downstream 1742623 21579926 ~ 21585161 (-) True XLOC_004113
TCONS_00007815 other downstream 3911469 19416178 ~ 19416315 (-) True XLOC_004096
TCONS_00007888 other upstream 322758 23655350 ~ 23655478 (-) True XLOC_004130
TCONS_00007910 other upstream 1193084 24525676 ~ 24532958 (-) True XLOC_004138
TCONS_00007913 other upstream 1635179 24967771 ~ 24967887 (-) True XLOC_004142
TCONS_00007916 other upstream 1872561 25205153 ~ 25205243 (-) True XLOC_004144
TCONS_00007927 other upstream 2143507 25476099 ~ 25476185 (-) True XLOC_004150

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000058_01794468_01800421.mRNA False 993 mRNA 0.46 8 CI01000058 1794468 ~ 1800421 (+)