RNA id: TCONS_00008180


Basic Information

Item Value
RNA id TCONS_00008180
length 619
RNA type mRNA
GC content 0.62
exon number 3
gene id XLOC_004281
representative True

Chromosome Information

Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 37431693 ~ 37589293 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGGGGAATGAAGCGAGCCTCGAAGGAGAGGGACAGCCGGGGCAACCGGGAGGCGCTGTCCCCGCGGCTGGAGCCCCGGCTTCCATTTCAGCACCAGCGGGCGGCGGACAGCTCCACAAGCCGAGCAATGGAGCGCCTGCCGGGGGAATGGGCACCGGACACGGGCCGGGAATGAACAGTATCCAAGGCAAACCGAATCAGACAGACCCTAGCATGGGACCCAAACCTGGAGGTCCACCCGGTGTGGGACCCGGCCCTGGAGCCCCAACACATCCTCAGGGTCCCAGTCAGAGTCAAGCCGCACGGAAGAACCTTCAGGTGGATGTGGGCGGCAGCAAAGGCGGGCCAGTCTCTCCCGGAAGCAGCGCTCCCACATCCCCCTATTCTCTACCCCAGATTGCACCCATGCCCAGCAGCAAGCTCTGTCCAGTGTGCAAGACTGCAGATTTGACGGGCACCACAGACGGCCAGCCAAACTGCAATAAATGCACACAGTGCCGCTCCATGGTGTGCAACCAATGCGGATTCAACCCCAACCCTCACCTCACTGAGGTGCAGGAGTGGTTGTGTCTGAACTGTCAGATGCAGAGGGCGTTGGGGATGGATATGGAGACTCCAC

Function

GO:

id name namespace
GO:0007416 synapse assembly biological_process
GO:0048786 presynaptic active zone cellular_component
GO:0045202 synapse cellular_component
GO:0046872 metal ion binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-120628-1 Predicted to enable metal ion binding activity. Predicted to act upstream of or within synapse assembly. Predicted to be located in cell projection and presynaptic active zone. Is expressed in brain and forebrain.

Ensembl:

ensembl_id ENSDART00000172989

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00008847 lncRNA downstream 32134 37475513 ~ 37476968 (-) True XLOC_004282
TCONS_00008173 lncRNA downstream 211005 37297501 ~ 37298097 (-) True XLOC_004278
TCONS_00008846 lncRNA downstream 413568 37085620 ~ 37095534 (-) True XLOC_004276
TCONS_00008171 lncRNA downstream 464563 37038420 ~ 37044539 (-) False XLOC_004275
TCONS_00008845 lncRNA downstream 465182 37040376 ~ 37043920 (-) True XLOC_004275
TCONS_00008487 lncRNA upstream 3715 37593008 ~ 37603964 (-) False XLOC_004283
TCONS_00008848 lncRNA upstream 11711 37601004 ~ 37603955 (-) False XLOC_004283
TCONS_00008849 lncRNA upstream 11711 37601004 ~ 37603961 (-) False XLOC_004283
TCONS_00008181 lncRNA upstream 11711 37601004 ~ 37603981 (-) True XLOC_004283
TCONS_00008488 lncRNA upstream 24254 37613547 ~ 37614538 (-) True XLOC_004284
TCONS_00008178 mRNA downstream 101 37431693 ~ 37509001 (-) False XLOC_004281
TCONS_00008177 mRNA downstream 83695 37313508 ~ 37425407 (-) True XLOC_004280
TCONS_00008176 mRNA downstream 97610 37310881 ~ 37411492 (-) False XLOC_004280
TCONS_00008175 mRNA downstream 149686 37310881 ~ 37359416 (-) False XLOC_004280
TCONS_00008172 mRNA downstream 388148 37105640 ~ 37120954 (-) True XLOC_004277
TCONS_00008182 mRNA upstream 93985 37683278 ~ 37693019 (-) False XLOC_004285
TCONS_00008183 mRNA upstream 96300 37685593 ~ 37691449 (-) False XLOC_004285
TCONS_00008185 mRNA upstream 119091 37708384 ~ 37717709 (-) False XLOC_004286
TCONS_00008186 mRNA upstream 119548 37708841 ~ 37720024 (-) False XLOC_004286
TCONS_00008187 mRNA upstream 128263 37717556 ~ 37720266 (-) True XLOC_004286
TCONS_00008174 other downstream 209617 37299371 ~ 37299485 (-) True XLOC_004279
TCONS_00008119 other downstream 2283963 35225022 ~ 35225139 (-) True XLOC_004254
TCONS_00008105 other downstream 3042589 34466395 ~ 34466513 (-) True XLOC_004247
TCONS_00008102 other downstream 3153440 34355544 ~ 34355662 (-) True XLOC_004245
TCONS_00008088 other downstream 3542830 33966158 ~ 33966272 (-) True XLOC_004234
TCONS_00008194 other upstream 585778 38175071 ~ 38175150 (-) True XLOC_004294
TCONS_00008207 other upstream 1358694 38947987 ~ 38949751 (-) True XLOC_004305
TCONS_00008210 other upstream 1500582 39089875 ~ 39089991 (-) True XLOC_004308
TCONS_00008222 other upstream 2593388 40182681 ~ 40182796 (-) True XLOC_004319
TCONS_00008236 other upstream 3088920 40678213 ~ 40696136 (-) True XLOC_004327

Expression Profile

//

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
grasscarp (Ctenopharyngodon idella) CI01000306_09825468_09827244.mRNA True 1534 mRNA 0.44 2 CI01000306 9824575 ~ 9827282 (-)