RNA id: TCONS_00008487



Basic Information


Item Value
RNA id TCONS_00008487
length 280
lncRNA type inter_gene
GC content 0.45
exon number 3
gene id XLOC_004283
representative False

Chromosome Information


Item Value
chromosome id NC_007122.7
NCBI id CM002895.2
chromosome length 45484837
location 37593008 ~ 37603981 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


TCAGCTCTGTAAAACAGCGTACATAGAGGAAAGACTTCGCTTATTCAGTGGGAAAAAACGAAGCAAACCATGATTTCATTAGGCGGTTTTGGAGTGGCAAATTATCGCTCTTCGGTTATTCCTGGTTTACCCCATTAGAGCAATCCTTCCCCAGCTGGGAAACAGCCGAAATATGAGGAAACCTCCATTCAGAAGACCCATCCTGTTCAACATGCAGCAGATTTCAGCTTTAGATTGGAAGAGCTTGTTGAAAAGGCATTGACGTACACTCACCGGCCTT

Function


GO:

id name namespace
GO:0044085 cellular component biogenesis biological_process
GO:0016070 RNA metabolic process biological_process
GO:0016071 mRNA metabolic process biological_process
GO:0016072 rRNA metabolic process biological_process
GO:0071826 ribonucleoprotein complex subunit organization biological_process
GO:0022613 ribonucleoprotein complex biogenesis biological_process
GO:0022618 ribonucleoprotein complex assembly biological_process
GO:0071840 cellular component organization or biogenesis biological_process
GO:0034470 ncRNA processing biological_process
GO:0006364 rRNA processing biological_process
GO:0090304 nucleic acid metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006396 RNA processing biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0030490 maturation of SSU-rRNA biological_process
GO:0006139 nucleobase-containing compound metabolic process biological_process
GO:0006725 cellular aromatic compound metabolic process biological_process
GO:1901360 organic cyclic compound metabolic process biological_process
GO:0010467 gene expression biological_process
GO:0042254 ribosome biogenesis biological_process
GO:0042273 ribosomal large subunit biogenesis biological_process
GO:0043170 macromolecule metabolic process biological_process
GO:0006807 nitrogen compound metabolic process biological_process
GO:0034641 cellular nitrogen compound metabolic process biological_process
GO:0034660 ncRNA metabolic process biological_process
GO:0046483 heterocycle metabolic process biological_process
GO:0008380 RNA splicing biological_process
GO:0030684 preribosome cellular_component
GO:0032040 small-subunit processome cellular_component
GO:0044422 obsolete organelle part cellular_component
GO:0044424 obsolete intracellular part cellular_component
GO:1990904 ribonucleoprotein complex cellular_component
GO:0044428 obsolete nuclear part cellular_component
GO:0070013 intracellular organelle lumen cellular_component
GO:0044446 obsolete intracellular organelle part cellular_component
GO:0044464 obsolete cell part cellular_component
GO:0032991 protein-containing complex cellular_component
GO:0005622 intracellular anatomical structure cellular_component
GO:0005623 obsolete cell cellular_component
GO:0005634 nucleus cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0031974 membrane-enclosed lumen cellular_component
GO:0031981 nuclear lumen cellular_component
GO:0043226 organelle cellular_component
GO:0043227 membrane-bounded organelle cellular_component
GO:0043229 intracellular organelle cellular_component
GO:0043231 intracellular membrane-bounded organelle cellular_component
GO:0043233 organelle lumen cellular_component
GO:0005730 nucleolus cellular_component
GO:0005488 binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0097159 organic cyclic compound binding molecular_function
GO:1901363 heterocyclic compound binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003729 mRNA binding molecular_function

KEGG:

id description
ko00230 Purine metabolism
ko00240 Pyrimidine metabolism
ko03020 RNA polymerase
ko03230 Viral genome structure
ko04623 Cytosolic DNA-sensing pathway
ko05164 Influenza A
ko05169 Epstein-Barr virus infection
ko05016 Huntington disease
ko03200 Viral proteins

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00008847 lncRNA downstream 116040 37475513 ~ 37476968 (-) True XLOC_004282
TCONS_00008173 lncRNA downstream 294911 37297501 ~ 37298097 (-) True XLOC_004278
TCONS_00008846 lncRNA downstream 497474 37085620 ~ 37095534 (-) True XLOC_004276
TCONS_00008171 lncRNA downstream 548469 37038420 ~ 37044539 (-) False XLOC_004275
TCONS_00008845 lncRNA downstream 549088 37040376 ~ 37043920 (-) True XLOC_004275
TCONS_00008488 lncRNA upstream 9583 37613547 ~ 37614538 (-) True XLOC_004284
TCONS_00008184 lncRNA upstream 83679 37687643 ~ 37692704 (-) True XLOC_004285
TCONS_00008850 lncRNA upstream 176614 37780578 ~ 37827473 (-) False XLOC_004287
TCONS_00008851 lncRNA upstream 199816 37803780 ~ 37827473 (-) True XLOC_004287
TCONS_00008852 lncRNA upstream 380987 37984951 ~ 37987558 (-) True XLOC_004290
TCONS_00008180 mRNA downstream 3715 37509102 ~ 37589293 (-) True XLOC_004281
TCONS_00008179 mRNA downstream 44297 37439687 ~ 37548711 (-) False XLOC_004281
TCONS_00008178 mRNA downstream 84007 37431693 ~ 37509001 (-) False XLOC_004281
TCONS_00008177 mRNA downstream 167601 37313508 ~ 37425407 (-) True XLOC_004280
TCONS_00008176 mRNA downstream 181516 37310881 ~ 37411492 (-) False XLOC_004280
TCONS_00008182 mRNA upstream 79314 37683278 ~ 37693019 (-) False XLOC_004285
TCONS_00008183 mRNA upstream 81629 37685593 ~ 37691449 (-) False XLOC_004285
TCONS_00008185 mRNA upstream 104420 37708384 ~ 37717709 (-) False XLOC_004286
TCONS_00008186 mRNA upstream 104877 37708841 ~ 37720024 (-) False XLOC_004286
TCONS_00008187 mRNA upstream 113592 37717556 ~ 37720266 (-) True XLOC_004286
TCONS_00008174 other downstream 293523 37299371 ~ 37299485 (-) True XLOC_004279
TCONS_00008119 other downstream 2367869 35225022 ~ 35225139 (-) True XLOC_004254
TCONS_00008105 other downstream 3126495 34466395 ~ 34466513 (-) True XLOC_004247
TCONS_00008102 other downstream 3237346 34355544 ~ 34355662 (-) True XLOC_004245
TCONS_00008088 other downstream 3626736 33966158 ~ 33966272 (-) True XLOC_004234
TCONS_00008194 other upstream 571107 38175071 ~ 38175150 (-) True XLOC_004294
TCONS_00008207 other upstream 1344023 38947987 ~ 38949751 (-) True XLOC_004305
TCONS_00008210 other upstream 1485911 39089875 ~ 39089991 (-) True XLOC_004308
TCONS_00008222 other upstream 2578717 40182681 ~ 40182796 (-) True XLOC_004319
TCONS_00008236 other upstream 3074249 40678213 ~ 40696136 (-) True XLOC_004327

Expression Profile


//