RNA id: TCONS_00013057



Basic Information


Item Value
RNA id TCONS_00013057
length 597
RNA type mRNA
GC content 0.52
exon number 2
gene id XLOC_006783
representative True

Chromosome Information


Item Value
chromosome id NC_007124.7
NCBI id CM002897.2
chromosome length 52186027
location 35904335 ~ 35908275 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GTTGGAGTAACGCATTCACATCACATGCGACCGTTTCTCTGTCGTTCAGTCAGCAGGGGTTAACTGCTGTTAGTGTTGATAAACTATTTTGCCTAGATAGACCAATCTCAACCGTTATGCATGTGCACTACAGATATGTGCATTTAATGCAGATATTCGTGTAGTAGTACATGGTCTGAAGCGATGCCTGGAGTCAACACCCAAACACTGTACGGCTGGGACATGGAGCACTACTTTTACGACGAGATGGACACCGAGGAGGACTTCTTTAAGTCTACGGCGCCGAGTGAGGATATATGGAAGAAATTCGAGCTGCTTCCCACCCCGCCCATGTCGCCCTCAAGGACGCTGGATGGGGACTGGTTATTCCCGATACCCGGGGACCGGCTTGGGTGGGCGCCGCCGAAGGTGTTAACGTGTGATGAGGAGTATGAGGGGCTTCACAAGTTCGACCCACTGGACATTTTTGGGAATCTGGGTTCAATTGTTATCAAAGACTGCATGTGGAGTGGACTTTCCACGAGTCACCGGCTGGAGAAGGTTGCGCATGGAGAGCGAGCACCGGTGGCCGCTCTGATCCAGAACTCGACCGCACAG

Function


GO:

id name namespace
GO:0006355 regulation of transcription, DNA-templated biological_process
GO:0045944 positive regulation of transcription by RNA polymerase II biological_process
GO:0005634 nucleus cellular_component
GO:0001228 DNA-binding transcription activator activity, RNA polymerase II-specific molecular_function
GO:0003677 DNA binding molecular_function
GO:0003700 DNA-binding transcription factor activity molecular_function
GO:0000978 RNA polymerase II cis-regulatory region sequence-specific DNA binding molecular_function
GO:0046983 protein dimerization activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2439 Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to be involved in regulation of transcription by RNA polymerase II. Predicted to act upstream of or within regulation of transcription, DNA-templated. Predicted to be located in nucleus. Is expressed in several structures, including axial mesoderm; nervous system; pectoral fin bud; presumptive neural retina; and shield. Orthologous to human MYCL (MYCL proto-oncogene, bHLH transcription factor).

Ensembl:

ensembl_id ENSDART00000147522

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00013044 lncRNA downstream 379543 35520974 ~ 35527405 (-) True XLOC_006778
TCONS_00013869 lncRNA downstream 617511 35205297 ~ 35289437 (-) False XLOC_006774
TCONS_00013868 lncRNA downstream 617573 35205297 ~ 35289375 (-) False XLOC_006774
TCONS_00013872 lncRNA upstream 17274 35925042 ~ 35925484 (-) True XLOC_006784
TCONS_00013080 lncRNA upstream 413596 36321364 ~ 36322604 (-) False XLOC_006796
TCONS_00013088 lncRNA upstream 622462 36530230 ~ 36535072 (-) False XLOC_006800
TCONS_00013091 lncRNA upstream 623792 36531560 ~ 36532726 (-) False XLOC_006800
TCONS_00013096 lncRNA upstream 661179 36568947 ~ 36582281 (-) False XLOC_006803
TCONS_00013053 mRNA downstream 14643 35880664 ~ 35892305 (-) False XLOC_006782
TCONS_00013052 mRNA downstream 14705 35880573 ~ 35892243 (-) False XLOC_006782
TCONS_00013054 mRNA downstream 14705 35889149 ~ 35892243 (-) False XLOC_006782
TCONS_00013055 mRNA downstream 14897 35889243 ~ 35892051 (-) True XLOC_006782
TCONS_00013049 mRNA downstream 61987 35787873 ~ 35844961 (-) False XLOC_006781
TCONS_00013059 mRNA upstream 66594 35974362 ~ 35976986 (-) True XLOC_006786
TCONS_00013060 mRNA upstream 76229 35983997 ~ 35984530 (-) True XLOC_006787
TCONS_00013061 mRNA upstream 76853 35984621 ~ 35985772 (-) True XLOC_006788
TCONS_00013062 mRNA upstream 87470 35995238 ~ 36034582 (-) True XLOC_006789
TCONS_00013063 mRNA upstream 130202 36037970 ~ 36049008 (-) False XLOC_006790
TCONS_00013051 other downstream 64359 35826667 ~ 35842589 (-) True XLOC_006781
TCONS_00013045 other downstream 314571 35592242 ~ 35592377 (-) True XLOC_006779
TCONS_00013041 other downstream 447017 35430544 ~ 35459931 (-) True XLOC_006776
TCONS_00013038 other downstream 536264 35370569 ~ 35370684 (-) True XLOC_006775
TCONS_00013037 other downstream 685335 35206835 ~ 35221613 (-) False XLOC_006774
TCONS_00013058 other upstream 54582 35962350 ~ 35962466 (-) True XLOC_006785
TCONS_00013072 other upstream 227648 36135416 ~ 36141351 (-) True XLOC_006792
TCONS_00013079 other upstream 413323 36321091 ~ 36391491 (-) False XLOC_006796
TCONS_00013081 other upstream 413663 36321431 ~ 36330899 (-) True XLOC_006796
TCONS_00013082 other upstream 491492 36399260 ~ 36399375 (-) True XLOC_006797

Expression Profile


//