RNA id: TCONS_00051746


Basic Information

Item Value
RNA id TCONS_00051746
length 372
RNA type mRNA
GC content 0.47
exon number 2
gene id XLOC_026515
representative True

Chromosome Information

Item Value
chromosome id NC_007114.7
NCBI id CM002887.2
chromosome length 62628489
location 33963247 ~ 34095221 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

AAACGTCTGAAACCATGATCGCCTCATCTCTCTGCTTATTTCTGCTTCTTGCAGCTGTCTCTCGTGTCCACTGTGTTGAACTGACCCAGACAGATTCTATTGTCTTGAGGCCTGGTCAGGTGTTGACTCTGTCTTGTAAAATCTCTGGATATTCAGTGACTGACAGCAGCTATTGCACTGACTTTATACGACAGGCTGCAGGAAAAGCTCTGGAATGGGTTGGGGAGATCTGTGGCAGCGGTAACACATATTACAGCGATAAACTGAAAAGTAGATTCACAGTTAGCAGAGACTCTTCCAGCAGCAGCGTGACTCTGAGTGGACAGAATATGCAGACTGAGGACACAGCTGTGTATTACTGCGCCAGACAAA

Function

GO: NA

KEGG: NA

ZFIN:

id description
ZDB-GENE-040514-18 Predicted to enable antigen binding activity and immunoglobulin receptor binding activity. Predicted to be involved in several processes, including activation of immune response; defense response to other organism; and phagocytosis. Predicted to be part of immunoglobulin complex, circulating. Predicted to be active in external side of plasma membrane.

Ensembl:

ensembl_id ENSDART00000151377

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00051677 lncRNA downstream 155939 33936453 ~ 33938821 (-) True XLOC_026512
TCONS_00051675 lncRNA downstream 159322 33922620 ~ 33935438 (-) False XLOC_026512
TCONS_00053065 lncRNA downstream 175565 33918566 ~ 33919195 (-) True XLOC_026511
TCONS_00051667 lncRNA downstream 404006 33681518 ~ 33690754 (-) True XLOC_026509
TCONS_00051659 lncRNA downstream 657028 33435754 ~ 33437732 (-) True XLOC_026506
TCONS_00053066 lncRNA upstream 44416 34139637 ~ 34141181 (-) True XLOC_026572
TCONS_00051762 lncRNA upstream 84586 34179807 ~ 34180432 (-) False XLOC_026573
TCONS_00051763 lncRNA upstream 84586 34179807 ~ 34180451 (-) True XLOC_026573
TCONS_00051771 lncRNA upstream 374933 34470154 ~ 34477363 (-) False XLOC_026575
TCONS_00051773 lncRNA upstream 430721 34525942 ~ 34546406 (-) False XLOC_026575
TCONS_00051745 mRNA downstream 1846 34092458 ~ 34092914 (-) True XLOC_026562
TCONS_00051744 mRNA downstream 3404 34091300 ~ 34091356 (-) True XLOC_026561
TCONS_00051743 mRNA downstream 4304 34089983 ~ 34090456 (-) True XLOC_026560
TCONS_00051742 mRNA downstream 5450 34088852 ~ 34089310 (-) False XLOC_026515
TCONS_00051741 mRNA downstream 7366 34086948 ~ 34087394 (-) True XLOC_026559
TCONS_00051747 mRNA upstream 293 34095514 ~ 34103123 (-) False XLOC_026563
TCONS_00051748 mRNA upstream 1292 34096513 ~ 34096987 (-) True XLOC_026564
TCONS_00051749 mRNA upstream 3038 34098259 ~ 34098731 (-) True XLOC_026565
TCONS_00051750 mRNA upstream 5051 34100272 ~ 34100700 (-) False XLOC_026563
TCONS_00051751 mRNA upstream 6410 34101631 ~ 34102075 (-) True XLOC_026566
TCONS_00051740 other downstream 8277 34086041 ~ 34086483 (-) True XLOC_026558
TCONS_00051725 other downstream 29824 34063955 ~ 34064936 (-) True XLOC_026547
TCONS_00051722 other downstream 36043 34058679 ~ 34058717 (-) True XLOC_026544
TCONS_00051716 other downstream 46107 34048205 ~ 34048653 (-) True XLOC_026539
TCONS_00051715 other downstream 47144 34047179 ~ 34047616 (-) True XLOC_026538
TCONS_00051752 other upstream 7736 34102957 ~ 34103365 (-) True XLOC_026563
TCONS_00051772 other upstream 430721 34525942 ~ 34546399 (-) False XLOC_026575
TCONS_00051781 other upstream 557089 34652310 ~ 34656737 (-) False XLOC_026581
TCONS_00051782 other upstream 557751 34652972 ~ 34654998 (-) False XLOC_026581
TCONS_00051787 other upstream 648358 34743579 ~ 34753541 (-) True XLOC_026582

Homologous

species RNA id representative length rna type GC content exon number chromosome id location
mexican tetra (Astyanax mexicanus) TU384804 True 487 TUCP 0.46 2 NW_019172441.1 159305 ~ 160048 (+)