RNA id: TCONS_00066063


Basic Information

Item Value
RNA id TCONS_00066063
length 342
RNA type mRNA
GC content 0.54
exon number 3
gene id XLOC_033767
representative False

Chromosome Information

Item Value
chromosome id NC_007118.7
NCBI id CM002891.2
chromosome length 74282399
location 27898091 ~ 28189681 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CGAGTGCGCAGGACCCGGCAGTCAGAGGAACAGGCTCCCCTCGTGGAGAGCTACCTCAGCGGAAACAGCAGCACCATCTACCACGTACAAGAAGCGGAACAGGAAGAAGTTAAAGCCGTAGCAGAGGTTCAGGCTCCTCGCTCGGCTAAAAAATCCAAGCCGCCTACCTCCACTCCTCAGACTGGCAGCGCCAAGAAGGAGAAAAAGGGCAAGCACAAAGGAATCTCAAGTAGCATGAACTTCGATGAAGAGGAGGACGAAGATGATTTGGTCAGCTCAAGCTCATCTCAGCTCAACAGCAACACAAGACCTGGCTCTGCCACCAGCAAAAAGTCCAGCAAG

Function

GO: NA

KEGG:

id description
ko04990 Domain-containing proteins not elsewhere classified

ZFIN:

id description
ZDB-GENE-121009-1 Predicted to be located in extracellular region. Orthologous to human TUB (TUB bipartite transcription factor).

Ensembl:

ensembl_id ENSDART00000173843

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00068858 lncRNA upstream 173773 27822444 ~ 27832323 (+) False XLOC_033764
TCONS_00068859 lncRNA upstream 173773 27823531 ~ 27832323 (+) False XLOC_033764
TCONS_00068860 lncRNA upstream 173773 27825631 ~ 27832323 (+) False XLOC_033764
TCONS_00068861 lncRNA upstream 173773 27828012 ~ 27832323 (+) True XLOC_033764
TCONS_00066053 lncRNA upstream 207061 27797821 ~ 27799035 (+) True XLOC_033762
TCONS_00068575 lncRNA downstream 30704 28058202 ~ 28089017 (+) False XLOC_033767
TCONS_00066064 lncRNA downstream 30704 28058202 ~ 28189681 (+) True XLOC_033767
TCONS_00068576 lncRNA downstream 1034677 29062175 ~ 29064397 (+) True XLOC_033780
TCONS_00066088 lncRNA downstream 1058064 29085562 ~ 29090937 (+) True XLOC_033782
TCONS_00066099 lncRNA downstream 1154578 29182076 ~ 29182727 (+) True XLOC_033789
TCONS_00066056 mRNA upstream 118213 27834130 ~ 27887883 (+) False XLOC_033766
TCONS_00066054 mRNA upstream 185120 27802480 ~ 27820976 (+) True XLOC_033763
TCONS_00066052 mRNA upstream 308862 27691647 ~ 27697234 (+) True XLOC_033761
TCONS_00066051 mRNA upstream 310423 27603211 ~ 27695673 (+) False XLOC_033761
TCONS_00066049 mRNA upstream 310483 27455321 ~ 27695613 (+) False XLOC_033761
TCONS_00066068 mRNA downstream 585173 28612671 ~ 28623292 (+) False XLOC_033771
TCONS_00066069 mRNA downstream 587535 28615033 ~ 28623271 (+) True XLOC_033771
TCONS_00066071 mRNA downstream 697421 28724919 ~ 28837318 (+) True XLOC_033772
TCONS_00066072 mRNA downstream 874288 28901786 ~ 28999142 (+) False XLOC_033773
TCONS_00066073 mRNA downstream 933020 28960518 ~ 28989859 (+) False XLOC_033773
TCONS_00066060 other upstream 93041 27912938 ~ 27913055 (+) True XLOC_033768
TCONS_00066057 other upstream 126503 27848010 ~ 27879593 (+) True XLOC_033766
TCONS_00066055 other upstream 180035 27825945 ~ 27826061 (+) True XLOC_033765
TCONS_00066050 other upstream 345368 27455340 ~ 27660728 (+) False XLOC_033761
TCONS_00066036 other upstream 869450 27059394 ~ 27136646 (+) False XLOC_033759
TCONS_00066065 other downstream 226146 28253644 ~ 28255177 (+) False XLOC_033769
TCONS_00066066 other downstream 227598 28255096 ~ 28258626 (+) True XLOC_033769
TCONS_00066067 other downstream 433965 28461463 ~ 28461578 (+) True XLOC_033770
TCONS_00066070 other downstream 697412 28724910 ~ 28733520 (+) False XLOC_033772
TCONS_00066080 other downstream 986641 29014139 ~ 29015168 (+) True XLOC_033776

Expression Profile

//