G212143


Basic Information

Item Value
gene id G212143
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 296456 ~ 296698 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU240664
TCTAAAGTCCCCGCCAAAGGAAGTAGTCCCTTTTAGCAATTTGTTAGCAACCGCCGTTTTTAAGACGCAATAAAGGTTTAAAAAATCACAAGCGGGTTATTACTGGTGTGTTTCATGTCATAGATCAAAATGTGAAAATATTTAGAGGCTTTGTTAACCACAGACCTTATTTCAGGCGATTTAGCAAATACCCATTCAAAAAACCCATAGACTTCGGGGCGATGGAACCGAAAGTCCTAAAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU240664 True 243 lncRNA 0.39 1 296456 296698

Neighbor

gene id symbol gene type direction distance location
CI01000050_00274836_00275609 NA coding upstream 20019 274695 ~ 276437 (+)
CI01000050_00235034_00262436 NA coding upstream 32837 235034 ~ 263619 (+)
CI01000050_00148346_00149410 RHO coding upstream 146675 148220 ~ 149781 (+)
CI01000050_00068652_00068867 NA coding upstream 227113 68652 ~ 69343 (+)
CI01000050_00012155_00026251 NA coding upstream 270205 12079 ~ 26412 (+)
CI01000050_00302983_00357876 CACNA1DB, CACNA1D coding downstream 6285 302983 ~ 358292 (+)
CI01000050_00376389_00376735 NA coding downstream 79519 376217 ~ 376964 (+)
CI01000050_00449181_00451580 NA coding downstream 152483 449181 ~ 452047 (+)
CI01000050_00457216_00463632 NA coding downstream 160232 456930 ~ 463646 (+)
CI01000050_00615170_00641706 NA coding downstream 318472 615170 ~ 641774 (+)
G212076 NA non-coding upstream 13191 283019 ~ 283265 (+)
G212141 NA non-coding upstream 13708 282487 ~ 282748 (+)
G212136 NA non-coding upstream 25191 271058 ~ 271265 (+)
G212017 NA non-coding upstream 106849 106065 ~ 189607 (+)
G211975 NA non-coding upstream 254845 25140 ~ 41611 (+)
G212185 NA non-coding downstream 138539 435237 ~ 435512 (+)
G212190 NA non-coding downstream 169005 465703 ~ 466360 (+)
G212188 NA non-coding downstream 169896 466594 ~ 467370 (+)
G212225 NA non-coding downstream 234033 530731 ~ 530950 (+)
G212226 NA non-coding downstream 234280 530978 ~ 531182 (+)
G212006 NA other upstream 158445 82604 ~ 138011 (+)
G212184 NA other downstream 136986 433684 ~ 434206 (+)
CI01000050_01296683_01297763 SELENOK other downstream 999948 1296365 ~ 1298255 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other downstream 1395105 1691374 ~ 1698973 (+)
G212927 NA other downstream 2478141 2774839 ~ 2775133 (+)
CI01000050_02852118_02864754 RNF122 other downstream 2546121 2852118 ~ 2865822 (+)

Expression


Co-expression Network