G212376


Basic Information

Item Value
gene id G212376
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000050
NCBI id null
chromosome length 7556436
location 1196025 ~ 1201801 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU240910
CCACTTTATACCTGGATACTGTCTGAAGAAACCTTTGGCGCTACCAAAGTACTGCCATATGAGAGAAGGGTCTCTATTAAAGTTGTCCACAAACACCTTATTTAGAGCCTCTGACCAGTACACCCCATTCACTATGGCTGCGTCTTTGTTGTACATGTTAGTGGGCACCTGGACGACACTGAGGCTGAGGTTTACAGACAGATTATTGAAATGTTCATTTGGCTGCAGGATGAATTCTCCACCCAGCTCCACACTCTTGCCCTCCTCATCCATCTCATTGATTAACACTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU240910 True 290 lncRNA 0.46 3 1196025 1201801

Neighbor

gene id symbol gene type direction distance location
CI01000050_01048195_01109752 NA coding upstream 86273 1047970 ~ 1109752 (+)
CI01000050_01039500_01042679 TLR9 coding upstream 153226 1039500 ~ 1042799 (+)
CI01000050_01023375_01033682 APEH coding upstream 161856 1023375 ~ 1034169 (+)
CI01000050_01002924_01005496 NA coding upstream 190511 1002924 ~ 1005514 (+)
CI01000050_00967544_00997883 BSN, BSNA coding upstream 198142 967544 ~ 997883 (+)
CI01000050_01261502_01265283 PARAPINOPSINA coding downstream 59566 1261367 ~ 1265283 (+)
CI01000050_01284083_01292321 NA coding downstream 82218 1284019 ~ 1293720 (+)
CI01000050_01296683_01297763 SELENOK coding downstream 94564 1296365 ~ 1298255 (+)
CI01000050_01301443_01316664 ACTR8 coding downstream 99642 1301443 ~ 1317171 (+)
CI01000050_01346318_01366815 CHDH coding downstream 144394 1346195 ~ 1367657 (+)
G212366 NA non-coding upstream 19982 1172134 ~ 1176043 (+)
G212296 NA non-coding upstream 285996 909813 ~ 910029 (+)
G212294 NA non-coding upstream 367940 827818 ~ 828085 (+)
G212293 NA non-coding upstream 368897 826804 ~ 827128 (+)
G212104 NA non-coding upstream 431590 763998 ~ 764435 (+)
G212357 NA non-coding downstream 31291 1233092 ~ 1233734 (+)
G212466 NA non-coding downstream 130566 1332367 ~ 1336316 (+)
G212473 NA non-coding downstream 156802 1358603 ~ 1363929 (+)
G212508 NA non-coding downstream 308132 1509933 ~ 1510161 (+)
G212522 NA non-coding downstream 345220 1547021 ~ 1548377 (+)
G212184 NA other upstream 761819 433684 ~ 434206 (+)
G212006 NA other upstream 1058014 82604 ~ 138011 (+)
CI01000050_00012155_00026251 NA other upstream 1169613 12079 ~ 26412 (+)
CI01000050_01691894_01697791 SULT1ST2, SULT1ST3 other downstream 490002 1691374 ~ 1698973 (+)
G212927 NA other downstream 1573038 2774839 ~ 2775133 (+)
CI01000050_02852118_02864754 RNF122 other downstream 1641018 2852118 ~ 2865822 (+)
CI01000050_03807697_03808793 CLCN5B, CLCN5 other downstream 2603342 3805143 ~ 3808870 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
zebrafish (Danio rerio) XLOC_036079 CACNA2D3 coding NC_007119.7 CM002892.2 53563949 ~ 53665111 (+)